AUCTORES
Research Article | DOI: https://doi.org/10.31579/2637-8914/128
1 China National Research Institute of Food and Fermentation Industries Co. Ltd, Beijing, 100015, China.
2 Qinghai Huzhu Barley Wine Co. Ltd, Haining, 810500, China.
3 College of Food Science and Pharmacy, Xinjiang Agricultural University, Urumqi, 830052, China.
*Corresponding Author: Chunguang Luan, China National Research Institute of Food and Fermentation Industries, No. 24, Jiuxianqiao Middle Road, Chaoyang District, Beijing, China.
Citation: Yishu Li, Heqiang Huang, Shengbao Feng, Shanbin Chen, Shanwen Li., et all (2023), The Alleviated Effect of α-Pinene on Amidst Alcoholic Liver Injury Pathology Through Autophagy Activation in Mice. J. Nutrition and Food Processing, 6(1); DOI:10.31579/2637-8914/128
Copyright: © 2023 Chunguang Luan, This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Received: 17 February 2023 | Accepted: 02 March 2023 | Published: 06 March 2023
Keywords: alcoholic liver injury; α-pinene; antioxidation; autophagy; inflammatory
Background: Alcoholic liver damage is caused by long-term and heavy alcohol consumption, which leads to many diseases and even cancer. α-Pinene has been shown to have antioxidant and anti-inflammatory activity, however, it is still unclear the relationship between α-Pinene and alcohol-induced liver injury. The potential molecular mechanisms of α-pinene in reducing alcohol-induced liver injury in mice were investigated in this study.
Materials and methods: The C57BL/6 mice were randomly divided into five groups, which were the control groups (physiological saline, 0.2mL per days), alcohol group (50% alcohol, 5 mL/kg bw/day), alcohol with low/medium/high dosage α-pinene treatment group ((7.2 mg/kg bw, 14.4 mg/kg bw, 28.8 mg/kg bw, dissolved in 50% alcohol, Separately). The dosing method for mice is via oral gavage. After 8 weeks of experimentation, mouse serum and liver were collected for further testing.
Result: The increased antioxidant enzyme activities demonstrated the alleviated effect of α-pinene against alcohol-induced mouse liver injury. Moreover, in liver tissues, α-pinene promoted nucleus translocation of nuclear factor-erythroid-2-related factor 2 (NRF2) and transcription of antioxidant target genes, including heme oxygenase 1 (HMOX-1 / HO-1), NAD[P]H quinone dehydrogenase 1 (NQO-1), and glutathione S-transferase alpha 1 (Gsta-1). Meanwhile, α-pinene promoted the protein expression of autophagy-related proteins and inhibited the increase of inflammatory factors caused by chronic alcohol intake. Furthermore, α-pinene partially inhibited the activation of apoptotic signaling pathways by increasing the expression of Bcl-2 and decreasing Bax and cleaved caspase-3 proteins.
Conclusion: Taken together, our results indicated that α-pinene might alleviate alcoholic liver injury by reducing lipid accumulation, enhancing anti-oxidative stress and anti-inflammatory, activating autophagy, and inhibiting cell apoptosis.
As a global health problem, alcoholic liver disease (ALD) is an important risk factor for metabolic diseases of the liver [1]. ALD mainly includes alcoholic hepatitis (AH), alcoholic fatty liver (AFLD), and chronic ALD [2]. ALD could further result in liver fibrosis, cirrhosis, and liver cancer[1]. More and more studies revealed that lipid accumulation, free radical accumulation, and endotoxin lipopolysaccharide (LPS)-induced inflammatory damage were closely relevant to the development of these diseases [2]. Meanwhile, Betaine, cannabidiol, and inulin, which played a role as an antioxidant, autophagy activator, anti-inflammatory agent, and anti-apoptotic respectively, have been used for the treatment of ALD and enhanced the liver's defence ability to improve alcoholic liver injury [3-5]. Therefore, like betaine, cannabidiol inulin, medicines developed from natural plants have become the focus for the prevention and treatment of ALD.
The α-pinene, with the chemical name of 2,6,6-trimetheylbicyclo [3.1.1] hept-2-ene, is a bicyclic monoterpene molecule found in various plants, including camphor, rosemary, and pine [6, 7]. Recently, α-pinene was also been found to be presented in the highland barley Baijiu [8]. Mahdieh et al. revealed that α-pinene could significantly reduce cerebral edema and infarct range, and improve neurobehavioral function by playing a protective role through restoring superoxide dismutase, catalase, glutathione peroxidase, and reducing MDA concentration (malondialdehyde), NO, and IL-6 in the hippocampus, cortex, and striatum [6]. In addition, α-pinene could significantly protect IEC-6 cells from cellular toxicity induced by aspirin and increased the ratio of cell survival by elevating GSH (glutathione) activity and reducing MDA [9]. the KEAP1 (Kelch-like ECH-associated protein 1)-NRF2 (activity of Nuclear factor-erythroid-2-related factor 2) pathway responds to oxidative stress [10]. Under normal conditions, NFE2L2 is negatively regulated by the cysteine-rich protein KEAP1 through proteasome degradation mediated by the CUL3 (cullin 3)-E3 ubiquitin ligase RBX1 (ring box 1) complex [11]. However, NRF2 is disassociated from KEAP1 and recruited into the nucleus when oxidative stress occurs. Furthermore, nucleus-translocated NRF2 activated the transcription of its target genes, including HMOX-1 / HO-1 (heme oxygenase 1), NQO-1 (NAD[P]H quinone dehydrogenase 1), and Gsta-1 (glutathione S-transferase alpha 1), which play an important role in the decrease of reactive oxygen species (ROS) level[12-14]. Further study revealed that oxidative stress and autophagy, which is a major intracellular degradation system that depends on lysosomes, have a mutual influence. For instance, the PtdIns3-phosphatase MTMR3 interacts with mTORC1 and suppresses its activity [15]Even though the antioxidant, anti-inflammatory, neuroprotective and analgesic effects of α-pinene have been discussed [7, 16], few studies focused on the exploration of a its effect on ALD.
This study investigated the possible protective effect of α-pinene on amidst ALD pathology in a mouse model of chronic liver injury. Our results suggest that α-pinene protects against alcoholic liver injury by reducing lipid accumulation, enhancing anti-oxidative stress and anti-inflammatory, activating autophagy, and inhibiting cell apoptosis.
Chemicals and reagents
α-pinene (purity>97%) purchased from Thermo Fisher Scientific Commercial kits were used to determine the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total cholesterol (TC), triglyceride (TG), high-density lipoprotein-cholesterol (HDL-C), low-density lipoprotein-cholesterol (LDL-C), malondialdehyde (MDA), superoxide dismutase (SOD), glutathione (GSH), and catalase (CAT). The primary antibodies against rabbit LC3, P62, and GAPDH were purchased from Cell Signaling Technology. The primary antibodies against mouse BCL-2 and the primary antibodies against rabbit NRF2, INOS, COX-2, NF-κB, caspase-3, and Lamin B2 were purchased from Proteintech Group. The secondary horseradish peroxidase (HRP)-labeled goat-anti-rabbit antibody was purchased from Cell Signaling Technology. All of the other chemicals used in this study were analytical grade.
Animals and experimental design
Male C57BL/6 mice (18–22 g body weight, bw) were obtained from Beijing Vital River Laboratory Animal Technology (Beijing, China). The Ethics Committee approved the present study of Joekai Biotechnology Co., Ltd. (JK (2021)-W-003, Beijing, China). The mice were individually housed in standard cages under a given temperature (23 ± 2°C) and humidity (60 ± 5%) with a 12-h light/dark cycle and were allowed free access to food and water. All protocols were carried out in accordance with the Guidance Suggestions for the Care and Use of Laboratory Animals, enacted by the Ministry of Science and Technology of China. After one week adaptation period, 50 mice were stochastically divided into five experimental groups, which were the control group, alcohol group, alcohol and low/medium/high dosage α-pinene treatment group [17]. The detailed information was shown in Table 1 (n=10).
Groups | Treatments |
Control | Vehicle-treated mice |
Alcohol | Alcohol-treated mice (5 mL/kg bw/day (2.0 g/kg bw/day)) |
AαL (Alcohol+ low dose α-pinene) | Alcohol-treated mice receiving low-dose α-pinene (5 mL/kg bw/day (7.2 mg/kg bw, dissolved in 50% alcohol)) intragastrically |
AαM (Alcohol+ medium dose α-pinene ) | Alcohol-treated mice receiving medium-dose α-pinene (5 mL/kg bw/day (14.4 mg/kg bw, dissolved in 50% alcohol)) intragastrically |
AαH (Alcohol+ high doseα-pinene) | Alcohol-treated mice receiving high-dose α-pinene (5 mL/kg bw/day (28.8 mg/kg bw, dissolved in 50% alcohol)) intragastrically |
Table 1: Experimental groups and treatments in 9 weeks.
Each group was given a gavage at the dose listed above. The dose of gavage in mice was based on the WHO[18], and National Institute on Alcohol Abuse and Alcoholism [21] recommends 12.0–15.0 g of pure alcohol for an adult male (60–70 kg/body weight [BW]). The specific dosage was further screened by the results of using cck-8 detection and then were calculated the appropriate dose according to the peripheral blood volume (as shown in Supplementary Figure). After the 8-week experiment, the mice were anesthetized and sacrificed after 12 h of fasting. Blood samples were collected and centrifuged after blood clot formation determination of serum marker enzymes and lipid levels. After resecting the liver, the organ was washed with cold saline and weighed. Two small sections of the same liver lobe were fixed in each animal for pathological observation. The remaining liver tissue was frozen in liquid nitrogen and stored at -80°C until analysis[19].
Biochemical analysis and pathological evaluation
The level of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total cholesterol (TC), triglyceride (TG), high-density lipoprotein-cholesterol (HDL-C), low-density lipoprotein-cholesterol (LDL-C), malondialdehyde (MDA) and the activities of superoxide dismutase (SOD), glutathione (GSH), and catalase (CAT) were determined according to the manufacturer's protocol (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). First, for pathological evaluation, the liver tissue was fixed with 4% paraformaldehyde. Then, the tissue (5 μm) was cut, trimmed, dehydrated, embedded, sectioned, stained, mounted, and finally microscopically inspected, and stained with hematoxylin-eosin (HE). Finally, the slides of livers were observed and photographed using an optical microscope[19].
Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis
The total RNA was isolated from the hippocampus using Eastep® Super Total RNA Extraction Kit. cDNA was obtained using a reverse transcription kit and analyzed using the ABI7500 Real-Time fluorescence quantitative PCR system with a fluorescent dye[19]. GAPDH was used as an internal reference, and the relative gene expressions of AMPK-α2, SREBP-1c, Hmox-1, Gsta-1, Nqo-1, LC3, P62, Beclin-1, TNF-α, NF-κB, IL-1β, IL-6, Bax, Bcl-2 were measured according to the 2-ΔΔCt formula[20]. The primers used are listed in Table 2.
Forward Primers | Reverse Primers | |
AMPK-α2 | GCTACCTATTTCCTGAAGACCCCTC | CTTGGTTCATTATTCTCCGATTGTC |
SREBP-1c | TAGAGCGAGCGTTGAACTGTATTG | CCATGCTGGAGCTGACAGAGAA |
NRF2 | TCTCCTCGCTGGAAAAAGAA | AATGTGCTGGCTGTGCTTTA |
Hmox-1 | TGCAGGTGATGCTGACAGAGG | GGGATGAGCTAGTGCTGATCTGG |
Gsta-1 | TGGGAATTTGATGTTTGACC | CAGGGCTCTCTCCTTCATGT |
Nqo-1 | CAGCCAATCAGCGTTCGGTA | CTTCATGGCGTAGTTGATGATGTC |
LC3 | GACGGCTTCCTGTACATGGTTT | TGGAGTCTTACACAGCCATTGC |
P62 | TGTGGAACATGGAGGGAAGAG | TGTGCCTGTGCTGGAACTTTC |
Beclin-1 | GTGCGCTACGCCCAGATC | GTGCGCTACGCCCAGATC |
TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
NF-κB | GAGGCACGAGGCTCCTTTTCT | GTAGCTGCATGGAGACTCGAACA |
IL-1β | CTCCATGAGCTTTGTACAAGG | TGCTGATGTACCAGTTGGGG |
IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
BAX | AGCAAACTGGTGCTCAAGGC | CCACAAAGATGGTCACTGTC |
Bcl-2 | AGTGGTATAGACAGGTCTGTTGG | CCCCACCGAACTCAAAGAAGG |
GAPDH | CTCAACTACATGGTCTACATGTTCCA | CCATTCTCGGCCTTGACTGT |
AMPK-α2 | GCTACCTATTTCCTGAAGACCCCTC | CTTGGTTCATTATTCTCCGATTGTC |
SREBP-1c | TAGAGCGAGCGTTGAACTGTATTG | CCATGCTGGAGCTGACAGAGAA |
NRF2 | TCTCCTCGCTGGAAAAAGAA | AATGTGCTGGCTGTGCTTTA |
Table 2: The sequence of primers used for qRT-PCR assay in this study.
Western blot analysis
The liver tissues were lysed with Protein Extract A containing protease inhibitor cocktails and centrifuged at 12,000 g for 15 min at 4°C. The total protein concentration from the supernatant was determined with a BCA protein assay kit. The proteins in the nucleus were passed through the nuclear protein extraction cassette. Samples were heated at 98°C for 10 min and then centrifuged at 13,800 g for 10 min. Next, 10 μL of supernatant was loaded onto each sample's 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. After electrophoresis, the proteins were transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was blocked with 5% milk for 1 h at room temperature in TBS/T (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Tween-20) and incubated overnight with primary antibodies at 4°C[21]. The membrane was washed three times with TBST for 10 minutes, incubated with secondary antibodies for 40 minutes, and developed with the Chenmi Scope 6200 Touch Chemiluminescence imaging system.
All of the data were expressed as mean ± standard error of means (SEM) and analyzed by SPSS 25 software. Significant differences among groups were tested by one-way analysis of variance (ANOVA) with P < 0>
Results
α-pinene alleviated pathology of alcoholic liver injury
As general indicators, ALT and AST in serum were used for the evaluation of liver injury. The results shown in Figure 1A, the level of serum ALT (p<0>
Then, HE staining photomicrographs of liver histology were conducted and the results were shown in Figure. 1D. Compared with control animals, daily alcohol intake caused more steatosis (fat accumulation) and greater inflammatory injury (Kupffer cell activation) in mice liver. Meanwhile, treatment with α-pinene alleviated the harmful effects of chronic alcohol intake and reduced the infiltration of Kupffer cells and hepatocytes in liver tissue, the same as biochemical analyses which also showed a potentially protective effect
Figure 1: α-pinene alleviated alcoholic liver injury. Effect of α-pinene on (A) serum marker enzymes and (B) lipids. (C) Representative photomicrographs of HE staining of liver sections. Alcohol treatment induced Hepatic steatosis (black arrow) and focal infiltration of lymphocytes (blue arrow). Values are expressed as the mean ± SEM (n = 10, *p< 0>
α-pinene is involved in the regulation of lipid peroxidation and multiple enzyme activities
The hepatic MDA, a marker of lipid peroxidation, and oxidative stress were detected in this study and the results were shown in Figure. 2A. MDA level was significantly increased after chronic alcohol feeding compared with the control group (p<0>
protects liver tissues from alcohol-consuming via downregulation of lipid peroxidation and upregulation of GSH level and SOD and CAT activities.
Previous studies implicated AMPK and SREBP as proteins involved in regulating lipid metabolism and synthesis [22, 23]. As shown in Figure. 2E–2F, chronic ingestion of alcohol dramatically increased the mRNA expression of SREBP-1c (p<0>
Figure 2. α-pinene treatment reduced lipid peroxidation and enhanced multiple enzyme activities. Effect of α-pinene on the levels of (A) MDA, and (B) GSH, (C) SOD activity, (D) CAT activity, and the expression of hepatic lipid relative mRNA levels of (E) AMPK-α2 and (F) SREBP-1c. Data are expressed as the mean ± SEM (n = 10, *p< 0>
α-pinene protects mice liver tissue by inhibiting oxidative stress
It has been suggested that the KEAP1-NRF2 pathway played an important role in responding to oxidative stress. As a transcription factor, NRF2 was translocated into the nucleus and upregulated the related target genes, including HMOX-1, Gsta-1, and NQO-1, among others, when the antioxidant mechanism was activated [24]. Therefore, nuclear proteins were separated in this study from the total protein of the mouse liver, and western blotting was employed to analyze the nuclear-translocated NRF2.
Compared with the control groups, nuclear-NRF2 decreased significantly in the alcohol group (p<0>
Figure 3. α-pinene promoted anti-oxidation. (A) The expression levels of NRF2 in the cell nucleus were detected by western blotting analysis. (B) Quantification of Nrf2 in cell nucleus expression. The mRNA levels of (C) HMOX-1, (D) Gsta-1, (E) Nqo-1. Data are expressed as the mean ± SEM (n = 10, *p< 0>
Autophagy was activated by α-pinene to protect mouse liver tissue
AMPK regulates fatty acids, glucose metabolism, and also an upstream key autophagy protein, mTOR [25]. To explore whether α-pinene can activate autophagy, the protein levels of two autophagy marker proteins, LC3 and P62, were detected. Compared with the control group, the LC3 was significantly decreased in the alcohol group (p<0>
Figure 4: The effect of α-pinene on autophagy. (A) The expression levels of LC3 and P62 in mouse liver were detected by western blotting analysis. (B) Quantification of LC3/GAPDH. (C) Quantification of P62/GAPDH. The mRNA levels of (D) LC3, (E) P62, and (F) Beclin-1. Data are expressed as the mean ± SEM (n = 10, *p< 0>
The expression levels of inflammatory mediators were suppressed by α-pinene
It is well known that cytokines play an important role in alcohol-induced mouse liver, including inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), nuclear factor kappa B (NF-κB), tumor necrosis factor-alpha (TNF-α), interleukin-1β (IL-1β), and interleukin-6
(IL-6) [26, 27]. Therefore, the expression level of INOS, COX-2, and NF-κB protein was detected. It was found that these cytokines in α-pinene treatment were significantly reduced compared to the alcohol groups (see Figure. 5A–5D). In addition, the mRNA expression levels of TNF-α, NF-κB, IL-1β, and IL-6 in mice livers were measured (see Figure. 5E–5H). Compared to the control group, these cytokines in the alcohol were significantly enhanced. However, these cytokines in α-pinene treatment were significantly reduced compared to alcohol groups.
Figure 5: α-pinene reduced inflammatory response. (A) The expression levels of INOS, COX-2, and NF-κB in mouse liver were detected by western blotting analysis. (B) Quantification of INOS/GAPDH. (C) Quantification of COX-2/GAPDH. (D) Quantification of NF-κB/GAPDH. The mRNA levels of (E) TNF-α, (F) NF-κB, (G) IL-1β, (H) IL-6. Data are expressed as the mean ± SEM (n = 10, *p< 0>
α-pinene protects mice liver tissue by inhibiting apoptosis
Caspase-3, a stable and inactive enzyme in normal cells, is processed into an active form when cells undergo apoptosis [28]. To investigate the effect of α-pinene on apoptosis, cleaved caspase-3 protein levels were monitored by western blot. The results showed that the expression of cleaved caspase-3 was significantly increased in the alcohol administration group compared with the control group (p<0>
apoptosis induced by chronic alcohol intake (AαL, AαM, AαH, p<0>
Figure 6: α-pinene declines apoptosis. (A) The expression levels of cleaved caspase-3 and BCL-2 in mouse liver were detected by western blotting analysis. (B) Quantification of cleaved caspase-3/GAPDH. (C) Quantification of BCL-2/GAPDH. The mRNA levels of (D) BAX and (E) BCL-2. Data are expressed as the mean ± SEM (n = 10, *p< 0>
Excessive alcohol consumption is a public health concern as it can lead to ALD, cirrhosis, and other related diseases [30, 31], which will further lead to the development of a variety of liver diseases, including fatty liver, AH, fibrosis, and cirrhosis [32]. Recent studies have shown that monoterpenoids have antioxidant and anti-inflammatory effects on protection cells [33, 34]. However, whether α-pinene played a similar role in chronic alcohol-induced liver injury should be investigated.
The study showed that long-term alcohol consumption caused liver injury as evidenced by elevation of serum ALT and AST activity, serum TC, TG, and LDL activity, as well as enlargement and fatty infiltration of hepatocytes, all of which reflected early biochemical and pathological changes in ALD [35]. However, after the treatment of α-pinene, the levels of these serum marker enzymes and lipids were close to normal or only slightly elevated, suggesting a protective role of α-pinene in liver cells (Figure. 1A–1C). In addition, histopathological liver changes induced by alcohol were also remarkably attenuated after α-pinene treatment (Figure. 1D). These results suggested that α-pinene was able to suppress the hepatotoxicity amidst chronic alcoholic liver injury[7, 9].
Chronic alcohol intake increases free radicals in the body, thereby leading to oxidative stress and alcoholic liver damage. Various pathways, including lipid peroxidation, the weakening of various antioxidant enzymes, the increase of lipogenesis, and the inhibition of fatty acid oxidation are thought to be involved in this process [36]. Our studies have confirmed that α-pinene can attenuate alcoholic liver damage and has a significant hepatoprotective effect, as evidenced by the significant reduction in lipid peroxidation marker MDA (Figure. 2A). In addition, the treatment of α-pinene also significantly increased the activities of antioxidant enzymes GSH, SOD, and CAT (Figure. 2B–D). Moreover, stimulation of AMPK can promote lipid metabolism and inhibit the expression of the SREBP-1c gene in mouse liver, which results in a decrease in adipogenesis and lipid accumulation [23]. However, α-pinene treatment significantly reduced the mRNA expression of SREBP-1c and significantly increased the expression of AMPK, following the decrease of TC and TG levels and the alleviation of liver histopathological changes.
These results indicate that α-pinene can inhibit alcohol-dependent lipid accumulation by regulating the balance between lipid synthesis and catabolism in mouse liver cells, which may be mediated by the upregulation of AMPK and the downregulation of SREBP-1c [removed]Figure. 2E–2F). Excessive lipid accumulation can induce oxidative stress [37]. Chang et al. suggested that enzyme-treated Z. latifolia extract protected cells from lipotoxicity by upregulating nuclear NRF2 levels and increasing the expression of downstream target genes HO-1, NQO1, and GCLC [38]. Our results showed that the expression level of NRF2 protein in the α-pinene treatment group increased in a concentration-dependent manner, with the maximum effect at AαH (Figure. 3A–3B) and it was consistent with previous research. In addition, after the treatment of α-pinene, the mRNA expression levels of target genes regulated by NRF2 increased in a concentration-dependent manner, with the maximum effect at AαH (Figure. 3C–3D). Therefore, the results of this study demonstrated that α-pinene could effectively exert an antioxidant effect and reduce the consequences of chronic alcohol ingestion to the mouse liver caused by oxidative damage.
In this study, changes in AMPK have been observed in lipid metabolism. Since the AMPK-mTOR pathway was a key pathway to regulating autophagy [39], we suspected that α-pinene could affect not only oxidative stress but also autophagy. Autophagy is a complex molecular mechanism in cells that can clean up damaged organelles and misfolded proteins in time [40, 41]. The expression levels of LC3-II and P62 were generally used to evaluate whether a certain substrate changes the autophagy flux of the cell. Typically, when autophagy is activated, the expression level of LC3-II increases, and the expression level of P62 decreases [42, 43]. In addition, Beclin-1 is an autophagy-related protein, its expression level will increase with the activation of autophagy [44]. The results showed that α-pinene treatment increased the mRNA expression level of LC3 and Beclin-1 in a concentration-dependent manner (Figure. 4A–4F). In contrast, the level of P62 decreased in a concentration-dependent manner. This result is consistent with our hypothesis that α-pinene protects the mouse liver by attenuating oxidative stress and activating autophagy (Figure. 4A–4F).
Inflammation is another factor that could cause liver disease, and its development would lead to the occurrence of many diseases. Long-term drinking can cause inflammation, and lead to an increasing level of inflammatory cytokines. Xiao-Jun Li et al. proved that α-pinene inhibits the inflammatory response and analgesia by inhibiting noxious stimulus-induced inflammatory infiltration and COX-2 over-expression [16]. Our study confirmed its anti-inflammatory effects by checking the protein expression of INOS, COX-2, NF-κB, and the mRNA expression levels of TNF-α, NF-κB, IL-1β, and IL-6 (Figure. 5A–5H). The results showed that the protein expression of INOS, COX-2, and NF-κB, and the mRNA expression level of inflammatory cytokines treated with α-pinene was significantly downregulated, which is consistent with the previous study. Ultimately, α-pinene potentially protected the mouse liver by upregulating NRF2-mediated antioxidants, activating autophagy, and downregulating the TNF-α, NF-κB, IL-1β, IL-6, and inflammation pathways[7, 16].
There was the study showed that salvianolic acid α-pinene could prevent P13K/AKT/mTOR stimulation from being inhibited, and the expression of α-SMA, HYP, the proteins Bax and caspase-3/cleaved caspase-3 were all reduced. On the contrary, the expression of Bcl-2 was increased and thereby inhibited cell apoptosis [45]. Our results suggested that cleaved caspase-3 was decreased by the treatment of α-pinene (AαL, p<0>
Interestingly, however, in the AαH group, the cleaved caspase-3 expression was similar to the alcohol group. The previous study showed that, when the autophagy flux exceeds the cell's capacity, it will induce apoptosis [46-48]. Therefore, this phenomenon may be caused by excessive autophagy. In addition, the anti-apoptotic protein BCL2 was activated in the AαH, which is inconsistent with typical apoptosis results and therefore it also may relate to autophagy. Under normal circumstances, BCL-2 binds to Beclin-1 and inhibits autophagy [49]. Our results suggested that the expression of Beclin-1 was upregulated by the treatment of α-pinene. This may lead to the dissociation of BCL-2 from Beclin-1 and activate autophagy. This may result in the abundance of BCL-2 protein increasing [50].
In addition, Sirtuin 1, The role of the anti-aging gene, may be relevant to the effects of α-pinene on autophagy, apoptosis and the therapy for alcoholic liver injury [51, 52]. The previous studies shows that Sirtuin 1 is intimately tied to NRF2 and transcription of antioxidant target genes, including heme oxygenase 1 (HMOX-1 / HO-1), NAD[P]H quinone dehydrogenase 1 (NQO-1), AMPK, mTOR to limit oxidative stress, increase life span, improve insulin sensitivity and maintain mitochondrial function [53, 54]. Sirtuin 1 is critical to regulate autophagy and inflammation [55]. Activators and inhibitors of Sirtuin 1 may be important to alcoholic liver disease and α-pinene may be a Sirtuin 1 activator [56]. The research on Sirtuin 1 will be determined in the follow-up experiments.
Conclusion
This study demonstrated that α-pinene might protect the mouse liver from alcohol consumption by activating NRF2-mediated oxidative stress and autophagy, downregulating inflammatory cytokines, and inhibiting apoptosis. Thus, our results demonstrated the effects of α-pinene on autophagy and apoptosis, it provided a new perspective for treating an alcoholic liver injury. However, the molecular mechanism of α-pinene on autophagy needs to be further investigated.
Declaration of Competing Interest
We declare that we have no conflict of interest.
Data availability
The data used to support the results of this study are available from the corresponding authors upon request and permission.
Author contribution
Deliang Wang, Feike Hao, and Chunguang Luan conceived and designed the experiments. Yishu Li performed the experiments and statistical analysis and wrote the manuscript. All authors read and approved the final manuscript.
Ethics approval statement
The Ethics Committee approved the present study of Joekai Biotechnology Co., Ltd. (JK (2021)-W-003, Beijing, China). All protocols were carried out in accordance with the Guidance Suggestions for the Care and Use of Laboratory Animals, enacted by the Ministry of Science and Technology of China.
Funding
This work was supported by the National Natural Science Foundation of China (grant number 32060532) and Science and Technology Plan Projects of Tibet Autonomous Region (grant number XZ202001ZY0017N).
Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.
Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.
Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.
Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.
We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.
The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.
Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.
Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.
Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.
Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.
Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.
This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.
Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.
As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.
Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.
International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.
Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.
Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.
I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!
"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".
I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.
We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.
I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.
I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.
I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.
Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.
“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.
Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.
Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.
Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.
The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.
Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.
Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, The review process for the article “The Handling of Anti-aggregants and Anticoagulants in the Oncologic Heart Patient Submitted to Surgery” was extremely rigorous and detailed. From the initial submission to the final acceptance, the editorial team at the “Journal of Clinical Cardiology and Cardiovascular Interventions” demonstrated a high level of professionalism and dedication. The reviewers provided constructive and detailed feedback, which was essential for improving the quality of our work. Communication was always clear and efficient, ensuring that all our questions were promptly addressed. The quality of the “Journal of Clinical Cardiology and Cardiovascular Interventions” is undeniable. It is a peer-reviewed, open-access publication dedicated exclusively to disseminating high-quality research in the field of clinical cardiology and cardiovascular interventions. The journal's impact factor is currently under evaluation, and it is indexed in reputable databases, which further reinforces its credibility and relevance in the scientific field. I highly recommend this journal to researchers looking for a reputable platform to publish their studies.
Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”
Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner
My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.
My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.
My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.