Research Article | DOI: https://doi.org/10.31579/2637-8914/121
Department of Biology, Faculty of Education, University of Khartoum
*Corresponding Author: Lina Ahmed Hassaballa, Department of Biology, Faculty of Education, University of Khartoum
Citation: Lina A. Hassaballa and Asaad A. Ahmed., (2023), Molecular Genetic Identification of Some Sweet Sorghum - Sorghum bicolor L. (Ankolib) Accessions – Sudan, J. Nutrition and Food Processing, 6(8); DOI:10.31579/2637-8914/121
Copyright: © 2023, Lina Ahmed Hassaballa. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Received: 04 September 2023 | Accepted: 06 October 2023 | Published: 09 October 2023
Keywords: ankolib; sweet sorghum; molecular genetics
This study is an attempt to identify some Sudanese Sweet Sorghum (Ankolib) [Sorghum bicolor (L.) Moench.] accessions using two types of DNA-based markers: RAPD and SSR. Seven (Ankolib) accessions were assayed, namely: Black Ankolib, Black White Ankolib, Dark Red Ankolib, Red Yellow Ankolib, White Ankolib, White Black Ankolib and Bengaga. All of the accessions were uniquely identified and fingerprinted. The levels of polymorphism among the accessions as revealed by (22) RAPD primers and (16) SSR primer pairs were (58%) and (76%) respectively, indicating that SSRs markers were highly polymorphic. The scored data of the two markers were analyzed using the Dice Coefficient to assess genetic relationships among the (7) (Ankolib) accessions. The results of the statistical analysis revealed that the accession Bengaga was distantly related to the other (6) accessions which all showed a close genetic similarity among them. UPGMA cluster analysis generated a dendrogram for each marker alone and for the combined data of the two markers. It was observed that in all of the dendrogram the accession Bengaga was found in a unique cluster thus indicating its uniqueness, since it is the only accession that has seeds that produce flour besides its juicy sweet stem.
The classification and identification of all known plants have gradually shifted from purely artificial systems to more accurate systems that are based on genetic experimentations. This development of Plant Taxonomy is a reflection of the development and application of new techniques. Taxonomists have now made the new techniques applied in the field of Ecology, Histology, Physiology, Biochemistry, Cytogenetic and Molecular Biology. The accurate, fast, reliable and cost-effective identification of plant population and varieties is essential in agriculture as well as in pure and applied plant research. Methods of varietals identification are most frequently based on assessment of a range of morphological characteristics, while these methods are very effective for many purposes, morphological comparison may have limitations including subjectivity in the analysis of the character, the influence of environmental or management practices on the character limited diversity among cultivars with highly similar pedigrees and the confining of expression of some diagnostic characters to a particular stage of development, such as flowering and fruit ripening. These considerations have led to the exploration or adoption of other techniques for varietals identification [1].New techniques based on DNA profiling provide novel approaches to varietals identification which offer advantages over all of other techniques (Figure. 8 & 10) and methods for demonstrating distinctness because: 1/ The DNA sequence of an organism is unique and independent of environmental conditions or management practices. 2/ The presence of the same DNA in every living cell of the plant allows tests of any tissue at any stage of growth (provided that the DNA is sufficient purity).3/ The recent advent of the polymerase chain reaction PCR has enabled the development of new DNA profiling techniques Table (3) that are simply and quickly performed. Therefore, attention has increasingly focused on the DNA molecule as a source of informative polymorphisms. DNA profiling techniques have two applications: 1/ DNA Fingerprinting, identifies individuals by the unique profile produced when their DNA is separated into a series of fragments and resolved into sized classes. This technique has potential in the specific identification of plant cultivars and their subsequent protection. 2/ Gene Mapping allows researchers to mark genes or chromosomes regions that are related to genetic traits such as pests or disease resistance, fruit size, fruit color and stress- tolerance…etc.
A particular advantage of such technique is that complex polygenic traits can be analyzed. Mapping techniques can also be used to isolate genes based entirely on their behavior. Once these have been identified, sequenced and cloned. Gene transfer techniques can be used to transfer them to other species. The sustainable development of large areas of the world is today one of the greatest challenges. The living conditions of large parts of the world population are greatly affected by the availability of energy, together with food and water. As most developing countries have limited fossil fuel indigenous resources, import of energy fills the increasing difference between demand and production. Consequently, nowadays a large number of motivation and a growing interest exist for the development of renewable sources of energy, like energy systems based on biomass, in particular energy crops, such as sweet sorghum.
Sweet sorghum has been selected as the main biomass resource for the following reasons:
- It has a very high yield (up to 80 tons/ha. of fresh matter) in terms of starch, sugar, ligno–cellulosic component and today can be considered as the most versatile and promising crop (food-feed-energy(.
- It has two times the photosynthetic efficiency in comparison with Sugar Beet, Soybean, Wheat…etc., (Its photorespiration can almost not be measured).
- It can be grown in a wide range of latitudes (tropical, sub- tropical and temperate zones) as well as on poor quality soil.
- It requires very low fertilizer and water input. The water requirement for growing sweet sorghum is one of the lowest: about 1/2 of the requirement for corn and about 1/3 of the requirement for sugar cane.
- Its growth period is short (4-5 months) in comparison with Sugar cane (8-24 months). The versatility of sweet sorghum is reflected in the range of research going on around the world into sweet sorghum production.
- It is a low water-use, stress tolerant crop with considerable potential for future small and large-scale exploitation. All these benefits and the importance of the sweet sorghum as the most promising (food-feed-energy) crop for the twenty-first century and its potential to aid development encourage the author to carry out this study. In this study we are going to identify some sweet Sorghum bicolor (L.) Moench. accessions in Sudan, using DNA-based markers like random amplified polymorphic DNA (RAPD) and simple sequence repeats (SSRs). Figure. (9).
Sweet Sorghum bicolor (L.) Moench. which represents the scope of this study, belongs to the family Gramineae (Poaceae). It can be classified as follows:
Kingdom: Plantae
Subkingdom: Tracheobionta
Superdivision: Spermatophyta
Division: Magnoliophyta
Class: Liliopsida
Subclass: Commelinidae
Order: Cyperales (Poales)
Family: Gramineae (Poaceae)
Genus: Sorghum Moench.
Species: Sorghum bicolor (L.) Moench
Botanical Description
Sorghum is a vigorous grass that varies between (0.5-5.0 m.) in height. It is an annual plant. It produces one or many tillers, which emerge initially from the base and later from stem nodes. The root system consists of fibrous adventitious roots that emerge from the lowest nodes of the stem, below and immediately above ground level. Roots are normally concentrated in the top (0.9 m.) of soil but may extend to twice that depth and can extend to (1.5 m.) in lateral spread. The stem is solid, usually erect. Its center can be dry or juicy, insipid or sweet to taste. The center of the stem can become pithy with spaces. Leaves vary in number from (6 – 24), depending on the cultivar. They are borne alternately in two ranks. Leaf sheaths vary in length between (15 - 35 cm.) and encircle the stem with their margins overlapping. The leaf sheath often has a waxy bloom. Leaves are from (30 - 135 cm.) long and (1.5 - 13 cm.) wide, with flat or wavy margins. Midribs are white or yellow in dry pithy cultivars or green in juicy cultivars. The inflorescence is a panicle, usually erect, but sometimes recurved to form a goose neck. The panicle has a central rachis, with short or long primary, secondary and sometimes tertiary branches, which bear groups of spikelets. The length and closeness of the panicle branches determine panicle shape, which varies from densely packed conical or oval to spreading and lax. The grain is usually partially covered by glumes. The seed is rounded and bluntly pointed, from (4 - 8 mm.) in diameter and varying in size, shape and color with cultivar.
Geographic Distribution
Sorghum originated in the north-eastern quadrant of Africa, where the greatest variability in wild and cultivated species is found to this day. It was probably domesticated in Ethiopia by selection from wild sorghum between (5.000 and 7.000) years ago. From this center of origin, it was distributed along trade and shipping routes throughout Africa, and through the Middle East to India at least (3.000) years ago. It reached China along the silk route. Sorghum was first taken to America through the slave trade from West Africa. It was reintroduced in late 19th century for commercial cultivation and has subsequently been introduced into South America and Australia. Although wild varieties of sorghum are attested as early as (8.000) years ago in the Nilotic regions of southern Egypt and Sudan, the location of its true domestication within East Africa is still speculative. It is widely held that genetics separation of domesticated Sorghum bicolor L. from its progenitor did not occur much before (2.000) years ago somewhere in East Africa, possibly the Ethiopian highlands, but more likely further west. The presence of true domesticated S. bicolor L. is claimed much earlier than this (3.700 – 4.900) years ago in India, Oman and Yemen, although the identity of the remains as full domesticates is still disputed. Sorghum is now widely found in the drier areas of Africa, Asia, America and Australia.
Uses of Sorghum bicolor (L.)
Sweet Sorghum bicolor (L.) Moench. is the only crop that provides grain and stem that can be used for sugar, alcohol, syrup, jaggery, fodder, fuel, bedding, roofing, fencing, paper and chewing [2]. Sweet sorghum has been widely used for the production of forage and silage for animal feed. It has also been used for nearly (150) years to produce concentrated syrup with a distinctive flavor [3]. [4] mentioned that, the primary products from sweet sorghum are based on exploiting the high levels of sugars found in the stem. These products include: Ethanol, Syrup, and Crystalline sugar, Electricity (produced from burning the residual fiber and Particle board or paper (from the fiber) Sucrose–type sweet sorghum, which mainly contains sucrose, can be used for refining crystal sugar. Syrup-type sweet sorghum, which mainly contains glucose, can be used for producing syrup; it is also a material of quality for making drinking wine and alcohol. [4], also noted that sweet sorghum has a medicinal use, the inflorescence has astringent, haemostatic and antidiarrhea properties and can be administered as infusion, tincture and medicinal wine. The stem is used in Nigerian traditional medicine for the treatment of anemia, especially during pregnancy. The oil crisis of (1973) and (1976) renewed interest in the commercial production of sweet sorghum for biological transformation into ethyl alcohol for use as fuel or fuel additive [5]. In Sudan grain sorghum contributes about (39%) of the calories in the human diet, while sweet sorghum is mainly used as fodder. In Sinnar Locality. The grains are ground and used as especial flour.
Molecular Studies
Recent advances in Molecular Biology, principally in the development of the polymerase chain reaction (PCR) for amplifying (DNA), (DNA) sequencing and data analysis have resulted in powerful techniques which can be used for the screening, characterization and evaluation of genetic diversity. The extensive number of research articles currently appearing in the literature, describing the use of these techniques in a wide range of plant species and diversity problems, is testimony to their increasing impact in this field. Application of (DNA) technology in seed research has progressed rapidly during the last ten years, especially in the area of cultivar identification. DNA fingerprinting technique has a promising application in this respect. A cultivar identification test based on (DNA) genetic fingerprints would be much faster than the official methods of variety identification, which require growing of suspect plants to the flowering stage, in parallel with control plants. [6] reported that the use of DNA-based markers for the genetic analysis and manipulation of important agronomic traits has become an increasing useful tool in plant breeding. DNA markers have the potential to enhance the operation of plant breeding programs through a number of ways ranging from genetic diversity, increasing the efficiency of selection for difficult traits and making environmental neutral selection possible. The problem of (DNA) extraction is still an important issue in the field of plant molecular biology. A good extraction procedure for the isolation of (DNA) should yield adequate and intact (DNA) of reasonable purity. The procedure should also be quick, simple and cheap. DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with (DNA) isolation procedures and downstream applications such as DNA restriction, amplification and cloning [7]. Various plants contain high levels of polysaccharides and many types of secondary metabolites affecting (DNA) purification. A good protocol for the isolation of (DNA) from leaf material containing large quantities of polyphenol, tannins and polysaccharides was reported by [8] using modified CTAB extraction method by applying high salt concentrations to remove polysaccharides and PVP to remove polyphenols. This modified CTAB protocol was used by [7] for (DNA) extraction from dry and fresh leaves of pearl millet (Pennisetum glaucum), they mentioned that this method solved the problems of (DNA) degradation, contamination and low yield due to binding and/or co-precipitation with starches and polysaccharides. [9] reported that, the knowledge of genetic relationships and distance among individuals provide useful information for breeders, and this can then be exploited to obtain the benefit from the potential of each population. They also stated that, molecular-assisted genetic analysis provide means to locate and select genes controlling important agronomic, pest-resistance, stress-tolerance and food quality traits. Genetic relationships facilitate the identification of diverse parents to cross in hybrid combination in order to maximize the expression of heterosis [10]; [11] and [12]. In India [13] reported that two sweet sorghum varieties (S21-3-1 and S23-1-1) were developed by crossing American lines with a local variety. These two varieties were found to be useful for their sugar content to produce ethanol and their grains to produce flour. Analysis of the extent and distribution of genetic variation in a crop is essential in understanding the evolutionary relationship between accessions and to sample genetic resources in a more systematic fashion for breeding and conservation purposes [14]. [15] mentioned that accurate identification of new varieties is essential to plant variety protection. The plant variety protection act (PVPA) of (1970) was established to help plant breeders protect their crop cultivars from commercial exploitation by others. DNA-based markers played a great role in this respect since they provide unique (DNA) fingerprints for plant varieties and cultivars ensuring their protection under the (PVPA). Various techniques have been used to mark individual characters in segregating population and constructing genetic maps. Initially, isozymes were used as markers. Recently, more precise marker techniques such as: RFLPs, RAPDs, AFLPs VNTRs and SSRs were widely used [16]. Each marker technique has its own advantages and disadvantages. The choice of a molecular marker technique depends on its reproducibility and simplicity. DNA markers are used to evaluate the genetic variation in gene banks, as well as to identify phylogenetic and molecular structure of crops and their associated wild species.
The RAPD Technique
PCR based marker like random amplified polymorphic (DNA) (RAPD) was developed independently by [17] and [18]. This technique was widely used to fingerprint a wide range of species from microorganisms to human. In plants, the technique is used to identify Wheat, Maize, Date, Palms, Corn and Soybean. cultivars The appeal of this technique was largely due to its ease in applications. However, the random nature of the primers makes the results non-reproducible. The advantages of this technique are:- The markers used seem to be virtually unlimited and are present in all organisms.- RAPD markers have a great potential to detect (DNA) Polymorphism between genotypes of the same species. Random amplified polymorphic DNA (RAPD) is quick [19]; [20] and well adapted for nonradioactive DNA fingerprinting of genotypes [21]. However, problems with the reproducibility in amplification of RAPD markers and with data scoring have been reported [22]. Although major bands from RAPD reaction are highly reproducible, minor bands can be difficult to repeat due to the random priming nature of this PCR reaction and potential confounding effects associated with co-migration with other markers [23]; [14] used (5) RAPD primers to fingerprint and detect the relationships among (17) sorghum cultivars, (11) Egyptian cultivars and (6) Yemenian cultivars. They reported that total number of (34) polymorphic bands with a level of (94%) polymorphism succeeded to discriminate the sorghum cultivars. [25] assayed (51) RAPD primers to determine the genetic distance among (8) Egyptian sweet sorghum cultivars. They found that (49) primers generated total number of (314) bands which were not necessarily present in each cultivar. (206) bands were found to be polymorphic and (108) bands were common in all of the eight cultivars. The dendrogram tree generated across the (49) primers divided the (8) cultivars into four clusters. The data showed different levels of variation among these cultivars.
The SSR Technique
Simple sequence repeats (SSRs) or microsatellites [26] generates a large number of restriction fragments (bands) facilitating the detection of polymorphism which is based on the number of repeat units in a defined region of the genome under investigation Table (3). SSRs are ubiquitous in eukaryotes. The number and composition of microsatellite repeats differ in plants and animals. The frequency of repeats longer than (20 bp.) has been estimated to occur every (33) kb in plants unlike mammals where it is found to occur every (6 kb.) [27]. In human, (AC) or (TC) are very common repeat units, but in plants AT is more common followed by AG or TC [28]. In general, plants have (10) times less SSRs than human. [29] Noted that the common SSRs in sorghum are: AG, AC, AAC and AAG. SSR markers are attractive for DNA fingerprinting studies for several reasons. They are co-dominant and highly informative, occur in high frequency and appear to be distributed throughout the genomes of most if not all of the higher plants and animals. SSRs generally, display high levels of polymorphism even among closely related accessions [30] and amenable to automated genotyping strategies. They also can be amplified by inexpensive PCR assays. Radioisotopes are not required in the detection of SSR markers because sequence polymorphism can usually be detected by separation. Most of Sorghum bicolor L. SSR loci showed a high level of polymorphism.
Preparation of Plant Materials:
Seeds of (7) sweet sorghum (Ankolib) accessions, namely, Black Ankolib Figure. (1), Black White Ankolib Figure. (2), Dark Red Ankolib Figure. (3), Red Yellow Ankolib Figure. (4), White Ankolib Figure. (5), White Black Ankolib Figure. (6) and Bengaga Fig. (7), were collected by the author from three different sites in Sudan. Names of accessions, sites of collection, glume color and seed color have been shown in Table (1). Similarly, the glume colors for the accessions have been indicated. The seed color of the accession Bengaga is illustrated.
Preparation of Solutions
1 -Extraction buffer: consist of 2% CTAB (w/v), 100mm. Tris pH (8.0), (20mM EDTA (pH 8.0), (1.4) m. NaCL and (0.03%) β-mercaptoethanol (50µl/sample).
2 -Purification solutions: Two solutions were used in this respect:
a- 50 µl Sodium acetate and (1) ml. ethanol absolute.
b- Chloroform: Isoamylalcohol (CI) 24:13-TE buffer: composed of (10) mm. Tris (pH 8.0) and (1) mm. EDTA (pH 8.0).
| No. | Name of Accession | Site | Glume color | Seed color |
| 1. | Black Ankolib | Sinnar | Black | Brown |
| 2. | B.W. Ankolib | Sinnar | Black & White | Brown & Creamy |
| 3. | D.R. Ankolib | Sinnar | Dark Red | Creamy |
| 4. | R.Y. Ankolib | Gadarif | Red & Yellow | Brown & Creamy |
| 5. | White Ankolib | Neyala | White | Creamy |
| 6. | W.B. Ankolib | Gadarif | White & Black | Brown & Creamy |
| 7. | Bengaga | Sinnar | Creamy | Orange |
Table 1: Names of Sweet Sorghum (Ankolib) accessions, site of collection, glume and seed color


Seed germination:
Seeds of each accession were germinated in pots in the lab and left to grow for a week.
DNA Extraction:
It is based on the hexa-decyltri-methylamonium bromide (CTAB) method to isolate DNA from tissues containing high levels of polysaccharides and secondary metabolites affecting DNA purification. This modified CTAB (2%) protocol includes the use of 1.4 M NaCL, (0.03%) β-mercaptoethanol, 50 µl sodium acetate and 1ml absolute ethanol for DNA extraction and purification as well as reducing the centrifugation times during the separation and precipitation of the DNA. The tubes were centrifuged at (10000 rpm for 15 min.) to precipitate DNA pellets. The solution in each tube was carefully poured off and the DNA pellets were washed again with (70%) ethanol and centrifuged at (10000 rpm for 2 min.) The solution was poured off and the pellets were air-dried. (200 µl) TE buffer or D.D.W. was added and the tubes were left at room temperature for (30 min.) to dissolve the DNA pellets and were then kept at (20˚C.) DNA purity was determined by a UV-VIS spectrophotometer at wave length of (260 nm). The purity was then calculated as the ratio of absorbance at (260 nm to 280 nm.).
Concentration of DNA:
The DNA was diluted by 1:5 in D.D.W. the samples were electrophoresed in (1%) agarose gel against (0.1 ng.) of a DNA size marker (Lambda DNA digested with Hind III and PHIX 174 DNA digested with Hae III). This marker covers a range of DNA fragments size between (23130 bp. and 310 bp.), and a range of concentration between 95 ng. and 11 ng.( Figure 5). The DNA concentration in a given sample was then estimated by comparing the degree of fluorescence of the unknown DNA band with the different bands in the DNA size marker.
DNA Purification:
Pure DNA was obtained according to the following procedure: 2 µl RNase were added to each eppendorf tube and the tubes were transferred to eppendorf thermomixer 5436 (37˚C) for (60 min.) 50 µl sodium acetate and 1 ml absolute ethanol were added to each tube and tubes were gently inverted and left for (10 min.) and left in refrigerater.
PCR Reaction
The PCR reaction comprises three steps: denaturation, annealing and extension. The procedure adopted with some modifications.
RAPD-PCR Technique
A program was set up and entered in the PCR apparatus to carry out the above mentioned steps using RAPD primers for (40) cycles as follows: denaturation at (94˚C) for (5) min., annealing at (36˚C) to amplify DNA for (45 sec/cycle) and finally extension at (72˚C for 1.5 min.). Another cycle of extension was conducted at (72˚C) for (7 min.). Table (3).
Preparation of Samples for RAPD-PCR Reaction
The samples contained a master mix and of DNA. The Master Mix consisted of 2.5 µl 10 X Taq Buffer, 2.5 µl d NTPs (2.5 mm.), 2 µl MgCl2 (25 mm.), 2 µl Primer 10 pmol, 0.3 µl Taq DNA Polymerase (5U/µl ) and 13.7 µl D.D.W. The 24 RAPD 10-mer primers used in this study were listed in table (2). 23 µl of the master mix were put in (0.2 ml.) eppendorf tube and 2 µl template DNA (10 ng) were added. The process was repeated 24 times for each DNA sample according to the primer's number. The tubes were transferred to PCR apparatus and the program was run. The RAPD-PCR products were stored in a refrigerator at (-20˚C).
| No. | Code | Sequence |
| 1 | OP-A01 | 5́ CAGGCCCTTC 3́ |
| 2 | OP-A02 | 5́ TGCCGAGCTG 3́ |
| 3 | OP-A07 | 5́ GTGACGTAGG 3́ |
| 4 | OP-A08 | 5́ GTGACGTAGG 3́ |
| 5 | OP-A09 | 5́ GGGTAACGCC 3́ |
| 6 | OP-A10 | 5́ GTGATCGCAC 3́ |
| 7 | OP-A12 | 5́ TCGGCGATAG 3́ |
| 8 | OP-A15 | 5́ TTCCGAACCC 3́ |
| 9 | OP-B02 | 5́ TGATCCCTGG 3́ |
| 10 | OP-B05 | 5́ TGCGCCCTTC 3́ |
| 11 | OP-B07 | 5́ GGTGACGCAG 3́ |
| 12 | OP-B12 | 5́ CCTTGACGCA 3́ |
| 13 | OP-B14 | 5́ TCCGCTCTGG 3́ |
| 14 | OP-B17 | 5́ AGGGAACGAG 3́ |
| 15 | OP-B18 | 5́ CCCACGCAGT 3́ |
| 16 | OP-B19 | 5́ ACCCCCGAAG 3́ |
| 17 | OP-C02 | 5́ GTGAGGCGTC 3́ |
| 18 | OP-C20 | 5́ ACTTCGCCAC 3́ |
| 19 | OP-G02 | 5́ GGCACTGAGG 3́ |
| 20 | OP-G03 | 5́ GAGCCCTCCA 3́ |
| 21 | OP-G04 | 5́ AGCGTGTCTG 3́ |
| 22 | OP-G05 | 5́ CTGAGACGGA 3́ |
| 23 | OP-G07 | 5́ GAACCTGCGG 3́ |
| 24 | OP-G09 | 5́ CTGACGTCAC 3́ |
Table (2): The Operon 10-mer random primers, code and sequence.
SSR -PCR Technique
Two programs were adopted here:
a- “Touchdown-PCR” adopted from Senior and with minor modifications. SSR primers for this program have been shown in table (3). 5 SSR primers were screened for amplification of a specific product from sweet sorghum genomic DNA using a (65˚C) – (55˚C) “touchdown-PCR” technique: denaturation at (94˚C) for (5) min, annealing for (40) cycles, the annealing temperature for the initial (10) cycles was decreased by one degree every cycle from (65˚C to 55˚C), followed by 30 cycles at (55˚C) and extension at (72˚C for 1.5 min.) followed by one more cycle of extension for (7 min.). Table (3).
b- This program was performed for each pair of the SSR primers presented in table (4) according to the annealing temperature of each primer. Sample according to the SSR primers used in the study. The tubes were placed in the PCR machine and the program was run. The PCR products were kept at (-20˚C).
| Primer sequence(*F and **R) | Primer ID | Code |
F:TGCGAAGAAAGCAGTAGCAAA R:TGGAGGTAGAAGACGCACG | ZM-ADH2N | A |
F:CCTCTACTCGCCAGTCGC R:TTTGGTCAGATTTGAGCACG | ZM-GPCI | B |
F:GGATGATGGACGTGCAGTC R:CTGGTACTGGTAGAGTCCACCC | MZE-ZEINP | C |
F:GTTTGGTCTTGCTGAAAAATAAAA R: GCTGGAGGCCTACATTATTATCTC | P-bnlg198 | S2 |
F: CTTCCCTCTCCCCATCTCCTTTCCAA R:GCAACCTGTCCATTCTCACCAGAGGATT | P-bnlg615 | S11 |
* F: Forward sequence
* R: Reverse sequence
Table (3). SSR Primers for PCR Amplifications.
Electrophoresis:
Preparation of Running Buffer
This buffer was composed of (50 ml.) TBE 10X( pH 8.0) [108g Tris, (55 g.) Boric Acid and (7.44 g.) EDTA in 1 L D.W.] dissolved in (950 ml.) D.W. Preparation of agarose gel (1.5%)
(1.5) g. of agarose gel were added to (100 ml.) TBE running buffer in (250 ml.) conical flask. The flask was shaken to dissolve the agarose gel, heated in a microwave for about (2 min.) and left to cool down at room temperature. 3 µl ethedium bromide were added to the cold melted gel, gently shaken and then poured in a gel tray with comb to form the wells where The PCR products were loaded and run.
Preparation of acrylamide gel (8%)
The gel was prepared by mixing the following materials:
6.7 ml. acrylamide,15.7 ml D.W., 175 µl TBE 10X, 12.5
TEMED and (10%) APS.
Preparation of samples for running:
(5µl) simple dye(loading dye) were added to each PCR product. Two markers were used to detected polymorphism among PCR products. Lambda X174 RF Hae III marker was used for RAPD-PCR products to determine molecular weight of bands run in (1.5%) agarose (gel. 100bp).
The gels were examined under UV light and were then photographed using a Polaroid Camera and Gel Doc.
The banding patterns generated by Basic-PCR markers RAPD and SSRs were compared to determine the genetic relatedness of the 97) sweet sorghum (Ankolib) accessions. Clear and distinct amplification products were scored as (1) for presence and (0) for absence of bands. Bands of the same mobility were scored as identical. The Genetic Similarity Coefficient (GS) between any two genotypes was estimated according to Dice Coefficient as follows:
Dice formula: GSij = 2a / (2a+b+c)
Where GSij = the measure of genetic similarity between two individuals i and j.
a = the number of bands shared by i and j.
b = the number of bands present in i and absent in j .
c = the number of bands present in j and absent in i .
Unweighted Pair Group Method using Arithmetic Average (UPGMA) was used for cluster analysis according to. In this method each accession represents an independent cluster and that distance between clusters were estimated by the Dice Coefficient. However, once several accessions have been linked together, the distance between two clusters is calculated as the average distance between all pairs of accessions in the two different clusters. Figure. (8).

Figure (8): RAPD profile for the (7) Sweet Sorghum (Ankolib) accessions as detected by primer B (OP-B12). Lanes (1) to (7) represent the (7) accessions M: Ф X174 RF Hae ш marker.

Figure. (9): RAPD histogram showing the levels of polymorphism as revealed by each RAPD primer.

Figure (10): RAPD profile for (7) Sweet Sorghum “Ankolib” accessions as detected by primers A (OP-A12) and B (OP-A15). Lan -es 1-7 represent the (7) accessions and M represents Φ X174RF Hae ш Marker.
Polymorphism detected by SSR markers:
The sixteen SSR primer pairs used in this study had successfully generated a total number of 81 bands. One pair (ZM-GPCI) generated only one monomorphic band. The total number of monomorphic fragments detected by the other
(15) SSR primer pairs was (19) ranging from (1) to(3) bands per primer. The total number of polymorphic bands was (62) ranging from (2) to (10) fragments per primer. This represented a level of polymorphism of (76%) and an average of (3.9) fragments per primer. The size of the amplified fragment also varied with the type of primer and it ranged from (50 bp. to 1,100 bp.). Table (4).
Identification of accessions using unique markers
Unique markers are defined as bands that specifically identify an accession from another by their presence or absence. The bands that are present in one accession but not found in other accessions are termed positive unique markers (PUM), in contrast to the negative unique markers (NUM), which are absent in a specific genotype. These bands are useful for cultivar identification and fingerprinting
| Primers | F: Forward and R: Reverse sequences | Total amp. | Mono. amp. | Poly. amp. | Poly.% |
| Sb4-15 | F:GCTGCTAAGCCGTGCTGA R:TTATTTGGGTGAAGTAGAGGTGAACA | 6 | 3 | 3 | 50% |
| Sb4-22 | F: TGAGCCGAAAACCGTGAG R: CCCAAAACCAAGAGGGAAGG | 2 | - | 2 | 100% |
| Sb4-32 | F: CTCGGCGGTTAGCACAGTCAC R: GCCCATAGACAGACAGCAAAGCC | 5 | 1 | 4 | 80% |
| Sb5-236 | F: GCCAAGAGAAACACAAACAA R: AGCAATGTATTTAGGCAACACA | 3 | 1 | 2 | 60% |
| Sb6-36 | F: GCATAATGACGGCGTGCTC R: CTTCCAAGTGAAAGAAACCATCA | 10 | 2 | 8 | 80% |
| Sb6-57 | F: ACAGGGCTTTAGGGAAATCG R: CCATCACCGTCGGCATCT | 2 | - | 2 | 100% |
| Sb6-84 | F: CGCTCTCGGGATGAATGA R: TAACGGACCACTAACAAATGATT | 4 | - | 4 | 100% |
| Sb6-313 | F: TTCTTCAGTTCGCACAGCATAA R: ACCTGCAGTGCACTTGACTATTG | 3 | 1 | 2 | 60% |
| Sb6-325 | F: AGCGCAGGAGCGCGAA R:TCATCCGCTACTACCGTACCGTCAGAAA | 3 | 1 | 2 | 60% |
| Xtxp4 | F: AATACTAGGTGTCAGGGCTGTG R: ATGTAACCGCAACAACCAAG | 10 | 1 | 9 | 90% |
| Xtxp19 | F: CTTTAATCGGTTCCAGAC R: CTTCCACCTCCGTACTC | 7 | 2 | 5 | 71% |
| ZM-ADH2N | F:TGCGAAGAAAGCAGTAGCAAA R: TGGAGGTAGAAGACGCACG | 13 | 3 | 10 | 76% |
| ZM-GPCI | F: CCTCTACTCGCCAGTCGC R: TTTGGTCAGATTTGAGCACG | 1 | 1 | - | 0% |
| MZE-ZEINP | F:GGATGATGGACGTGCAGTC R:CTGGTACTGGTAGAGTCCACCC | 5 | 1 | 4 | 80% |
| P-bnlg198 | F: GTTTGGTCTTGCTGAAAAATAAAA R: GCTGGAGGCCTACATTATTATCTC | 3 | 1 | 2 | 60% |
| P-bnlg615 | F: CTTCCCTCTCCCCATCTCCTTTCCAA R:GCAACCTGTCCATTCTCACCAGAGGATT | 4 | 1 | 3 | 75% |
| Total | 81 | 19 | 62 | ||
| Average | 5.1 | 1.2 | 3.9 | 76% |
Table (4). Primers sequence, the total number of amplicons (amp.), monomorphic amplicons, polymorphic amplicons and percentage of polymorphism as revealed by SSR analysis.

Figure. (11). SSR histogram showing the levels of polymorphism as revealed by each SSR primer pairs.
Accessions identification by unique RAPD markers
In this study, the RAPD technique was successful in characterizing all of the (7) tested (Ankolib) accessions by unique positive and/or negative markers. These markers ranged in size from (275 bp to 3,000 bp.). A total number of (67) unique markers were identified by the (22) RAPD primers used in this study. Out of the 22 primers, 3 primers (OP-A-15, OP-B-19 and OP-C-20) exhibited only one positive unique marker while 4 primers (OP-A-07, OP-B-05, OP-C-02 and OP-G-02) showed only one negative unique marker. The accession Bengaga showed the highest number (27) of the unique markers from which 14 were positive and 13 were negative. This number (27) was obtained from (14) different RAPD primers.
Genetic relationships among the (7) Sweet Sorghum Ankolib accessions as revealed by RAPD markers:
To examine the genetic relationships among the study samples based on RAPD results, the scored data were analyzed using the Dice Coefficient to compute the genetic similarity matrices. These similarity matrices were then used to generate a dendrogram using the UPGMA method. The estimated genetic similarity matrices among the accessions ranged from (73.7 to 89.5) thus revealing high levels of genetic similarity among the studied accessions. The highest genetic similarity percentage (90%) is between the accessions: Black Ankolib and Black White Ankolib followed by 89
Traditionally, genetic resources in sorghum are classified by taxonomists based on morphological traits governed by a relatively small number of genes. On the other hand, important traits, which are related to habitat adaptation and exhibit enormous variability among sorghum germ plasma, are complex and quantitatively inherited [14].
Molecular genetic identification has become a routine tool in the field of Plant Taxonomy. DNA based fingerprinting technologies have been proven a useful tool in genetic similarity and genetic relationship studies. The recently developed PCR based marker techniques, which include RAPD and SSRs are playing an increasingly important role in this type of investigation. In this study RAPD and SSRs techniques were applied to assess three parameters: the first parameter is the assessment of the level of polymorphisms among seven sweet sorghum Ankolib Sorghum bicolor (L.) Moench. accessions collected from three sites in Sudan namely (Sinnar, Gadarif and Neyala). The second parameter is the identification of unique markers and generating a DNA fingerprint for each accession. The third parameter is the estimation of the genetic relationships among the genotypes.
From the results it was found that, each of the two DNA-based markers, RAPD and SSRs, succeeded in detecting a level of polymorphism of (58%) and (76%) respectively. loci are sufficiently polymorphic and indicated that the level of polymorphism at some loci was high enough to allow the vast majority of S. bicolor accessions to be distinguished from one another. This is particularly useful in determining the genotypes at small number of loci, perhaps as few as half a dozen. This finding is also confirmed by a number of studies [29]; [30]. The increased resolution of acrylamide gel over agarose gel could enhance the separation and detection of a larger number of alleles per locus than agarose gel. This may be particularly important for SSR loci containing dinucleotide repeats, since PCR products differing by two base pairs cannot be resolved by agarose gels alone. That is why in the present study, we re-electrophoressed all the SSR-PCR products using 8
From the above discussion it can be concluded that DNA-based markers are useful tools for identification, fingerprinting and assessment of genetic relationships of sweet sorghum. This study can be summarized as follows:
This molecular genetic identification study on sweet sorghum would provide basic molecular genetic data for its genetic engineering in Sudan. Sweet sorghum is a very high biomass yielding crop. It can be grown as grain crop, feed crop, sugar crop and energy crop for making ethanol and electricity. Using the ethanol as fuel instead of petrol, it will not only save petrol but also can decrease environmental pollution.
Dear Editorial Team, Clinical Medical Reviews and Reports. My experience with the journal was highly positive. The peer-review process was rigorous, constructive, and completed in a timely manner. The reviewers provided valuable comments that helped improve the quality and clarity of our manuscript. The editorial office was professional, responsive, and supportive throughout all stages of the publication process. Communication was clear and efficient, and any questions were addressed promptly. Overall, I found the journal to maintain high scientific standards and an excellent publication workflow. I would be pleased to consider submitting future work to this journal. Best wishes from, Elena Popa.
It was my pleasure to submit my testimonial concerning the Reviewer Board of our Scientific Journal “Brain and Neurological Disorders”. The Reviewers focused on some modifications and their contribution was helpful. The ladies of our Editorial Office were also supported my efforts. It was my honor to have such a co-operation and I am looking forward for more collaboration.
Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Thank you for the speedy and efficient peer review process. I appreciate the fact that your peer reviewers do not take months to respond like with some other journals. I would also like to thank the editorial office for responding quickly to my questions. It is an excellent journal. I plan to submit more manuscripts in the future. Best wishes from, Robert W. McGee
Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Working with you and your team on our recent publication in JCRR has been a truly wonderful and enjoyable experience. The responses were prompt, and the reviewers were patient, constructive, and highly professional. One reviewer in particular gave me the feeling that a professor was carefully reading and commenting on my coursework, which was deeply touching. The entire process was straightforward and hassle‑free, with no tedious online forms to complete. I highly recommend this journal. Best wishes from, DR Aibing Rao, Head of R&D
I Appreciate the Opportunity to Share my Experience with the Journal of Clinical Research and Reports. The peer review process was timely and constructive, and the feedback provided helped improve the quality of our manuscript. The editorial office was professional, responsive, and supportive throughout the process, ensuring smooth communication and efficient handling of the submission. Overall, it was a positive experience collaborating with your team.
Dear Mercy Grace, Editorial Coordinator of Obstetrics Gynecology and Reproductive Sciences, We would like to express our gratitude for your help at all stages of publishing and editing the article. The editors of the magazine answer all the necessary questions and help at every stage. We will definitely continue to cooperate and publish other works in the Obstetrics Gynecology and Reproductive Sciences! Best wishes from, Alla Konstantinovna Politova,
Dear Maria Emerson, Editorial Coordinator of International Journal of Clinical Case Reports and Reviews, What distinguishes International Journal of Clinical Case Report and Review is not only the scientific rigor of its publications, but the intellectual climate in which research is evaluated. The submission process is refreshingly free of unnecessary formal barriers and bureaucratic rituals that often complicate academic publishing without adding real value. The peer-review system is demanding yet constructive, guided by genuine scientific dialogue rather than hierarchical or authoritarian attitudes. Reviewers act as collaborators in improving the manuscript, not as gatekeepers imposing arbitrary standards. This journal offers a rare balance: high methodological standards combined with a respectful, transparent, and supportive editorial approach. In an era where publishing can feel more burdensome than research itself, this platform restores the original purpose of peer review — to refine ideas, not to obstruct them Prof. Perlat Kapisyzi, FCCP PULMONOLOGIST AND THORACIC IMAGING.
Dear Reader: We have published several articles in the Auctores Publishing, LLC, journal, Clinical Medical Reviews and Reports in recent years (CMRR). This is an ‘open access’ journal and the following are our observations. From the initial invitation to submit an article, to the final edits of galley proofs, we have found CMRR personnel to be professional, responsive, rapid and thorough. This entire process begins with Catherine Mitchell, Editorial Coordinator. She is simply outstanding, and, I believe, unparalleled in her capacity. I cannot imagine a more responsive and dedicated Editorial Coordinator. As I read the dates and timing of her correspondence with us, it seems that she never sleeps. I hope Auctores Publishing, LLC, appreciates her efforts as much as these authors do. Thank you to Auctores Publishing, LLC, to the Editorial Staff/Board, and to Catherine Mitchell from a grateful author(s).
Dear Maria Emerson, Editorial Coordinator of - Journal of Clinical Research and Reports. ''I am pleased to provide this testimonial following the publication of our recent case report in this journal. The peer review process was rigorous, constructive, thorough, and conducted in a timely manner. The reviewers’ comments were thoughtful, detailed, and highly constructive, contributing substantially to the refinement, clarity, and scientific robustness of our manuscript. The process was conducted with professionalism and academic integrity throughout. The support provided by the editorial office was exemplary. Communication was consistently prompt, clear, and courteous at all stages of the submission and publication process. The editorial team demonstrated a high level of organization and responsiveness, ensuring that all queries were addressed efficiently and that the process remained transparent and well-coordinated. The overall quality of the journal is reflected in its strong editorial standards, commitment to scientific excellence, and dedication to publishing clinically meaningful research. It has been a privilege to publish our work in this journal, and we would welcome the opportunity to contribute further in the future.'' Best wishes from, Dr. Efstratios Trogkanis, Cardiologist.
Dear Grace Pierce, Editorial Coordinator of the journal IJCCR, I had a very positive experience with Auctores - Journal throughout the publication process. The Editorial Team was highly responsive, professional, and supportive at every stage. I would like to extend my sincere thanks to the Editor: Grace Pierce, for her guidance and assistance. The peer-review process was smooth and constructive, helping improve the quality of my work. I would gladly recommend Auctores Journal to fellow researchers and authors. Dr. SABITA SINHA, Medical Oncologist, MD (Electro Homeopathy).
Dear Mayra Duenas, Editorial Coordinator of the journal IJCCR, I write here a little on my experience as an author submitting to the International Journal of Clinical Case Reports and Reviews (IJCCR). This was my first submission to IJCCR and my manuscript was inherently an outsider’s effort. It attempted to broadly identify and then make some sense of life’s under-appreciated mysteries. I initially had responded to a request for possible submissions. I then contacted IJCCR with a tentative topic for a manuscript. They quickly got back with an approval for the submission, but with a particular requirement that it be medically relevant. I then put together a manuscript and submitted it. After the usual back-and-forth over forms and formality, the manuscript was sent off for reviews. Within 2 weeks I got back 4 reviews which were both helpful and also surprising. Surprising in that the topic was somewhat foreign to medical literature. My subsequent updates in response to the reviewer comments went smoothly and in short order I had a series of proofs to evaluate. All in all, the whole publication process seemed outstanding. It was both helpful in terms of the paper’s content and also in terms of its efficient and friendly communications. Thank you all very much. Sincerely, Ted Christopher, Rochester, NY.
International Journal of Clinical Case Reports and Reviews is a high quality journal that has a clear and concise submission process. The peer review process was comprehensive and constructive. Support from the editorial office was excellent, since the administrative staff were responsive. The journal provides a fast and timely publication timeline.
Dear Cecilia Lilly, Editorial Coordinator, Endocrinology and Disorders, Thank you so much for your quick response regarding reviewing and all process till publishing our manuscript entitled: Prevalence of Pre-Diabetes and its Associated Risk Factors Among Nile College Students, Sudan. Best regards, Dr Mamoun Magzoub.
Dear Editorial Team, Clinical Cardiology and Cardiovascular Interventions. I am really grateful for the peers review; their feedback gave me the opportunity to reflect on the message and impact of my work and to ameliorate the article. The editors did a great job in addition by encouraging me to continue with the process of publishing.
Dear Mayra Duenas, Editorial Coordinator of ‘International Journal of Clinical Case Reports and Reviews Herewith I confirm an optimal peer review process and a great support of the editorial office of the present journal
Dear Maria Emerson, Editorial Coordinator of ‘International Journal of Clinical Case Reports and Reviews’, I appreciate the opportunity to publish my article with your journal. The editorial office provided clear communication during the submission and review process, and I found the overall experience professional and constructive. Best regards, Elena Salvatore.
Dear Editorial Team, Journal-Clinical Cardiology and Cardiovascular Interventions, “Publishing my article with Clinical Cardiology and Cardiovascular Interventions has been a highly positive experience. The peer-review process was rigorous yet supportive, offering valuable feedback that strengthened my work. The editorial team demonstrated exceptional professionalism, prompt communication, and a genuine commitment to maintaining the highest scientific standards. I am very pleased with the publication quality and proud to be associated with such a reputable journal.” Warm regards, Dr. Mahmoud Kamal Moustafa Ahmed
Dear Editorial Team, Clinical Cardiology and Cardiovascular Interventions. It was truly a rewarding experience to work with the journal “Clinical Cardiology and Cardiovascular Interventions”. The peer review process was insightful and encouraging, helping us refine our work to a higher standard. The editorial office offered exceptional support with prompt and thoughtful communication. I highly value the journal’s role in promoting scientific advancement and am honored to be part of it. Best regards, Meng-Jou Lee, MD, Department of Anesthesiology, National Taiwan University Hospital.
Dear Maria Emerson, Editorial Coordinator, Journal of Clinical Research and Reports. Thank you for publishing our case report: "Clinical Case of Effective Fetal Stem Cells Treatment in a Patient with Autism Spectrum Disorder" within the "Journal of Clinical Research and Reports" being submitted by the team of EmCell doctors from Kyiv, Ukraine. We much appreciate a professional and transparent peer-review process from Auctores. All research Doctors are so grateful to your Editorial Office and Auctores Publishing support! I amiably wish our article publication maintained a top quality of your International Scientific Journal. My best wishes for a prosperity of the Journal of Clinical Research and Reports. Hope our scientific relationship and cooperation will remain long lasting. Thank you very much indeed. Kind regards, Dr. Andriy Sinelnyk Cell Therapy Center EmCell
I recommend without hesitation submitting relevant papers on medical decision making to the International Journal of Clinical Case Reports and Reviews. I am very grateful to the editorial staff. Maria Emerson was a pleasure to communicate with. The time from submission to publication was an extremely short 3 weeks. The editorial staff submitted the paper to three reviewers. Two of the reviewers commented positively on the value of publishing the paper. The editorial staff quickly recognized the third reviewer’s comments as an unjust attempt to reject the paper. I revised the paper as recommended by the first two reviewers.
Dear Chrystine Mejia, Editorial Coordinator, Journal of Neurodegeneration and Neurorehabilitation. “The peer review process was efficient and constructive, and the editorial office provided excellent communication and support throughout. The journal ensures scientific rigor and high editorial standards, while also offering a smooth and timely publication process. We sincerely appreciate the work of the editorial team in facilitating the dissemination of innovative approaches such as the Bonori Method.” Best regards, Dr. Matteo Bonori.
Dear Maria Emerson, Editorial Coordinator, we have deeply appreciated the professionalism demonstrated by the International Journal of Clinical Case Reports and Reviews. The reviewers have extensive knowledge of our field and have been very efficient and fast in supporting the process. I am really looking forward to further collaboration. Thanks. Best regards, Dr. Claudio Ligresti
Dear Ms. Mayra Duenas, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews. “The International Journal of Clinical Case Reports and Reviews represented the “ideal house” to share with the research community a first experience with the use of the Simeox device for speech rehabilitation. High scientific reputation and attractive website communication were first determinants for the selection of this Journal, and the following submission process exceeded expectations: fast but highly professional peer review, great support by the editorial office, elegant graphic layout. Exactly what a dynamic research team - also composed by allied professionals - needs!" From, Chiara Beccaluva, PT - Italy.
Dear Clarissa Eric, Editorial Coordinator, Journal of Clinical Case Reports and Studies, Auctores Publishing LLC, USA Office: +1-(302)-520-2644. I would like to express my sincere appreciation for the efficient and professional handling of my case report by the ‘Journal of Clinical Case Reports and Studies’. The peer review process was not only fast but also highly constructive—the reviewers’ comments were clear, relevant, and greatly helped me improve the quality and clarity of my manuscript. I also received excellent support from the editorial office throughout the process. Communication was smooth and timely, and I felt well guided at every stage, from submission to publication. The overall quality and rigor of the journal are truly commendable. I am pleased to have published my work with Journal of Clinical Case Reports and Studies, and I look forward to future opportunities for collaboration. Sincerely, Aline Tollet, UCLouvain.
Dear Chrystine Mejia, Editorial Coordinator, Journal of Neurodegeneration and Neurorehabilitation, Auctores Publishing LLC, We would like to thank the editorial team for the smooth and high-quality communication leading up to the publication of our article in the Journal of Neurodegeneration and Neurorehabilitation. The reviewers have extensive knowledge in the field, and their relevant questions helped to add value to our publication. Kind regards, Dr. Ravi Shrivastava.
Dear Clarissa Eric, Editorial Coordinator, Journal of Clinical Case Reports and Studies, I would like to express my deep admiration for the exceptional professionalism demonstrated by your journal. I am thoroughly impressed by the speed of the editorial process, the substantive and insightful reviews, and the meticulous preparation of the manuscript for publication. Additionally, I greatly appreciate the courteous and immediate responses from your editorial office to all my inquiries. Best Regards, Dariusz Ziora
Dear Ashley Rosa, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews, Auctores Publishing LLC. Thank you for publishing our article, Exploring Clozapine's Efficacy in Managing Aggression: A Multiple Single-Case Study in Forensic Psychiatry in the international journal of clinical case reports and reviews. We found the peer review process very professional and efficient. The comments were constructive, and the whole process was efficient. On behalf of the co-authors, I would like to thank you for publishing this article. With regards, Dr. Jelle R. Lettinga.
Dear Jessica Magne, Editorial Coordinator, Clinical Cardiology and Cardiovascular Interventions, Auctores Publishing LLC. The peer review process of the journal of Clinical Cardiology and Cardiovascular Interventions was excellent and fast, as was the support of the editorial office and the quality of the journal. Kind regards Walter F. Riesen Prof. Dr. Dr. h.c. Walter F. Riesen.
Dear Erin Aust, Editorial Coordinator, Journal of General Medicine and Clinical Practice. We are pleased to share our experience with the “Journal of General Medicine and Clinical Practice”, following the successful publication of our article. The peer review process was thorough and constructive, helping to improve the clarity and quality of the manuscript. We are especially thankful to Ms. Erin Aust, the Editorial Coordinator, for her prompt communication and continuous support throughout the process. Her professionalism ensured a smooth and efficient publication experience. The journal upholds high editorial standards, and we highly recommend it to fellow researchers seeking a credible platform for their work. Best wishes By, Dr. Rakhi Mishra.
Dr Hala Al Shaikh This is to acknowledge that the peer review process for the article ’ A Novel Gnrh1 Gene Mutation in Four Omani Male Siblings, Presentation and Management ’ sent to the International Journal of Clinical Case Reports and Reviews was quick and smooth. The editorial office was prompt with easy communication.
Dear Agrippa Hilda, Editorial Coordinator, Journal of Neuroscience and Neurological Surgery. The entire process including article submission, review, revision, and publication was extremely easy. The journal editor was prompt and helpful, and the reviewers contributed to the quality of the paper. Thank you so much! Eric Nussbaum, MD
Dear Ashley Rosa, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews. Many thanks for publishing this manuscript after I lost confidence the editors were most helpful, more than other journals Best wishes from, Susan Anne Smith, PhD. Australian Breastfeeding Association.
Dear Maria Emerson, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews, Auctores Publishing LLC. I am delighted to have published our manuscript, "Acute Colonic Pseudo-Obstruction (ACPO): A rare but serious complication following caesarean section." I want to thank the editorial team, especially Maria Emerson, for their prompt review of the manuscript, quick responses to queries, and overall support. Yours sincerely Dr. Victor Olagundoye.
Dear Jessica Magne, Editorial Coordinator, Clinical Cardiology and Cardiovascular Interventions, Auctores Publishing LLC. I appreciate the journal (JCCI) editorial office support, the entire team leads were always ready to help, not only on technical front but also on thorough process. Also, I should thank dear reviewers’ attention to detail and creative approach to teach me and bring new insights by their comments. Surely, more discussions and introduction of other hemodynamic devices would provide better prevention and management of shock states. Your efforts and dedication in presenting educational materials in this journal are commendable. Best wishes from, Farahnaz Fallahian.
Dear Ashley Rosa, Editorial Coordinator of the journal - Psychology and Mental Health Care. " The process of obtaining publication of my article in the Psychology and Mental Health Journal was positive in all areas. The peer review process resulted in a number of valuable comments, the editorial process was collaborative and timely, and the quality of this journal has been quickly noticed, resulting in alternative journals contacting me to publish with them." Warm regards, Susan Anne Smith, PhD. Australian Breastfeeding Association.
Dear Jessica, and the super professional team of the ‘Clinical Cardiology and Cardiovascular Interventions’ I am sincerely grateful to the coordinated work of the journal team for the no problem with the submission of my manuscript: “Cardiometabolic Disorders in A Pregnant Woman with Severe Preeclampsia on the Background of Morbid Obesity (Case Report).” The review process by 5 experts was fast, and the comments were professional, which made it more specific and academic, and the process of publication and presentation of the article was excellent. I recommend that my colleagues publish articles in this journal, and I am interested in further scientific cooperation. Sincerely and best wishes, Dr. Oleg Golyanovskiy.
To Dear Erin Aust – Editorial Coordinator of Journal of General Medicine and Clinical Practice! I declare that I am absolutely satisfied with your work carried out with great competence in following the manuscript during the various stages from its receipt, during the revision process to the final acceptance for publication. Thank Prof. Elvira Farina
My article, titled 'No Way Out of the Smartphone Epidemic Without Considering the Insights of Brain Research,' has been republished in the International Journal of Clinical Case Reports and Reviews. The review process was seamless and professional, with the editors being both friendly and supportive. I am deeply grateful for their efforts.
We found the peer review process quick and positive in its input. The support from the editorial officer has been very agile, always with the intention of improving the article and taking into account our subsequent corrections.
Dear Jessica Magne, with gratitude for the joint work. Fast process of receiving and processing the submitted scientific materials in “Clinical Cardiology and Cardiovascular Interventions”. High level of competence of the editors with clear and correct recommendations and ideas for enriching the article.
I thank the ‘Journal of Clinical Research and Reports’ for accepting this article for publication. This is a rigorously peer reviewed journal which is on all major global scientific data bases. I note the review process was prompt, thorough and professionally critical. It gave us an insight into a number of important scientific/statistical issues. The review prompted us to review the relevant literature again and look at the limitations of the study. The peer reviewers were open, clear in the instructions and the editorial team was very prompt in their communication. This journal certainly publishes quality research articles. I would recommend the journal for any future publications.
"I am grateful for the opportunity of contributing to [International Journal of Clinical Case Reports and Reviews] and for the rigorous review process that enhances the quality of research published in your esteemed journal. I sincerely appreciate the time and effort of your team who have dedicatedly helped me in improvising changes and modifying my manuscript. The insightful comments and constructive feedback provided have been invaluable in refining and strengthening my work".
To Dear Erin Aust, I would like to express my heartfelt appreciation for the opportunity to have my work published in this esteemed journal. The entire publication process was smooth and well-organized, and I am extremely satisfied with the final result. The Editorial Team demonstrated the utmost professionalism, providing prompt and insightful feedback throughout the review process. Their clear communication and constructive suggestions were invaluable in enhancing my manuscript, and their meticulous attention to detail and dedication to quality are truly commendable. Additionally, the support from the Editorial Office was exceptional. From the initial submission to the final publication, I was guided through every step of the process with great care and professionalism. The team's responsiveness and assistance made the entire experience both easy and stress-free. I am also deeply impressed by the quality and reputation of the journal. It is an honor to have my research featured in such a respected publication, and I am confident that it will make a meaningful contribution to the field.
I would like to express my sincere gratitude for the support and efficiency provided by the editorial office throughout the publication process of my article, “Delayed Vulvar Metastases from Rectal Carcinoma: A Case Report.” I greatly appreciate the assistance and guidance I received from your team, which made the entire process smooth and efficient. The peer review process was thorough and constructive, contributing to the overall quality of the final article. I am very grateful for the high level of professionalism and commitment shown by the editorial staff, and I look forward to maintaining a long-term collaboration with the International Journal of Clinical Case Reports and Reviews.
Dear Agrippa Hilda- Editorial Coordinator of Journal of Neuroscience and Neurological Surgery, "The peer review process was very quick and of high quality, which can also be seen in the articles in the journal. The collaboration with the editorial office was very good."
I would like to offer my testimony in the support. I have received through the peer review process and support the editorial office where they are to support young authors like me, encourage them to publish their work in your esteemed journals, and globalize and share knowledge globally. I really appreciate your journal, peer review, and editorial office.
My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.
My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.
My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.
Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner
Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”
Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.
Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.
The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.
Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.
Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.
Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.
“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.
Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.
I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.
I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.
I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.
We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.
I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.
"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".
I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!
Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.
Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.
International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.
Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.
As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.
Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.
This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.
Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.
Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.
Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.
Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.
Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.
The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.
We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.
Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.
Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.
Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.
Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.