AUCTORES
Globalize your Research
Research Article
*Corresponding Author: Ampati Srinivas, Deportment of Medicinal chemistry, Unity College of pharmacy, Bongir, India. E-mail: drampaty@gmail.com
Citation: Ampati Srinivas and Kokkula Pavan Kumar, Differentiation of Human Embryonic Stem Cells into Engrafting Myogenic Precursor Cells. J. Stem cell Research and Therapeutics International, DOI: 10.31579/2643-1912/005
Copyright: © 2019 Ampati Srinivas, This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Received: 21 March 2019 | Accepted: 12 April 2019 | Published: 16 April 2019
Keywords: limbal stromal cells; bone marrow mesenchymal stromal cells; adipose mesenchymal stem cells; gene expression profiling; microarray; limbal epithelial stem cells
Limbal epithelial stem cells (LESC) have great potential in treating the blindness caused by corneal damage. LESC are maintained in stem cell niche called Palisade of Vogt. Limbal stromal (LS) cells are critical component of LESC niche and help in their self renewal. These cells resemble mesenchymal stromal/stem cells with multilineage differentiation potential. However little is known about their gene expression profile compared to MSC derived from various sources.
Human cornea on the front surface of eye is very critical for vision. The corneal transparency, continuous regeneration and functionality of corneal epithelium play an important role in refraction of light on to the retina. Corneal epithelium is regenerated by unique population of stem cells called limbal epithelial stem cells (LESC) that are located in the basal region of limbus. LESC differ from the corneal epithelium due to the lack of corneo-specific differentiation keratins (K3/K12) expression [1-3], connexin 43-mediated gap junction intercellular communication [4-6], p63 nuclear transcription factor [7,8], cell cycle duration [9], and label retaining property [10]. The limbal stroma provides a unique stem cell niche or microenvironment which is important for the modulation of stemness as it is heavily pigmented, highly innervated and vascularized. Clinically, destruction of LESC or the limbal stromal niche can lead to a pathological stage of LESC deficiency with severe loss of vision [11]. Chronic inflammation in the limbal deficient stroma is sufficient to cause detrimental damage to the conjunctival limbal autograft transplanted to patients or experimental rabbits [12]. These findings suggest that the limbal stromal niche is critical in regulating the self-renewal and the fate of LESC. Although the mechanism remains elusive, modulation of epithelial proliferation, differentiation, proliferation and apoptosis by the limbal stroma has been reported to favor stemness [13]. Limbal stromal (LS) cells are very important component of limbal stromal niche that helps in self renewal of LESC. Recently, LS cells were shown to have multilineage differentiation potential [14-17]. In one of the studies, an ABCG2-expressing FACS sorted side population cells from limbal stroma were able to differentiate into chondrocytes and neurons following differentiation induction [14]. In other studies, multipotent cells were also found in corneal stroma [15] and limbal stroma [16-17]. Earlier, we have reported that an ex vivo expanded LS cells possess multipotent differentiation potential towards adipocytes, osteocytes and chondrocytes [18]. Other stromal cells such as mesenchymal stem/stromal cells (MSC) can also be isolated and expanded in vitro for tissue regeneration applications [19-22]. MSC were first identified from bone marrow aspirates [23,24] and subsequently in Wharton's jelly of human umbilical cords [25], adipose tissue [26], dental tissues [27,28] and skin [29]. Most of the stromal cells derived from various sources expressed the markers of MSCs such as CD44, CD73, CD90, CD105, STRO1 and do not express markers of hematopoietic lineage such as CD14, CD34, CD45 and HLA-DR [30].
In order to find out the specific molecular signature, cellular function and potential biomarkers of the LS cells, we compared the global gene expression profile including long non-coding RNA (lincRNA) of the expanded LS cells with the MSCs derived from bone marrow, adipose tissue and foreskin fibroblasts. In addition, we also evaluated the effects of two different culture conditions on the LS cells gene expression.
Establishment of limbal stromal cell culture
Corneoscleral rims from three cadaveric donors were obtained from post cornea graft transplantation with informed consent from the donor's relative. The rims were washed with phosphate buffer saline (PBS; Invitrogen Corporation, Carlsbad, CA) and then trimmed to remove the sclera. The limbal tissues were incubated at 37°C for 2 h with dispase (BD Biosciences, Mississauga, Canada) at a concentration of 5 mg/mL. The limbal tissues were then cut into approximately 2 mm explants after washing with PBS. The limbal explants were cultured on matrigel (BD Biosciences, Mississauga, Canada) coated plates with complete medium containing Dulbecco's Modified Eagle's Medium (DMEM)/F12, 10% knockout serum replacement, 10 µg/mL insulin, 5 µg/mL transferrin, 5 µg/mL selenium-X, 100 IU/mL penicillin, 100 µg/mL streptomycin (all from Invitrogen Corporation, Carlsbad, CA, USA), 10 ng/mL leukemia inhibitory factor (LIF) (Sigma-Aldrich Chemic, Steinheim, Germany) and 4 ng/mL basic fibroblast growth factor (bFGF; BD Biosciences, Mississauga, Canada) [17]. The expanded limbal stromal cells were subjected to fluorescenceactivated cells sorting (FACS) for the isolation of stage-specific embryonic antigen 4 (SSEA-4+) cells as reported previously [18]. The sorted SSEA-4+ cells were propagated on matrigel coated plate with the medium as mentioned previously. The limbal stromal cells that were maintained in this matrigel system were named as LS-matrigel. On the other hand, some of the sorted cells were maintained on normal plates with Dulbecco's Modified Eagle's Medium (DMEM)/F12 supplemented with 10% fetal bovine serum (FBS), 100 IU/mL penicillin, 100 µg/mL streptomycin (all from Invitrogen Corporation, Carlsbad, CA, USA). These cells were identified as LS-FBS.
Human bone marrow mesenchymal stromal/stem cells (BM-MSC) culture
Bone marrow MSC from three different lots (Millipore, Billerica, MA) were propagated and cultured according to manufacturer's protocol. Briefly, cells at passage 4 were cultured on 0.1% gelatin coated plates with Mesenchymal Stem Cell Expansion Medium (Millipore, Billerica, MA) supplemented with 8 ng/mL fibroblast growth factor-2 (FGF-2) (Millipore, Billerica, MA). When the cells were approximately 80% confluent, they were dissociated with trypsin-EDTA (Invitrogen Corporation, Carlsbad, CA) and passaged or alternatively frozen for later use.
Human adipose-derived mesenchymal stromal/stem cells (AD-MSC) and human foreskin fibroblast cells (HFF) culture.
Cryopreserved AD-MSC and HFF (n=3) at early passage (2- 3) were obtained from Stempeutics Research Malaysia and propagated in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin and 100 µg/mL streptomycin (all from Invitrogen Corporation, Carlsbad, CA). When the cells were approximately 80% confluent, they were dissociated with trypsin-EDTA (Invitrogen Corporation, Carlsbad, CA) and passaged or alternatively frozen for later use.
Total RNA extraction and quality assessment
LS-FBS (S1-P3, S3-P4 and S6-P3), LS-matrigel (S1-P6, S3-P6 and S6-P5), BM-MSC (BM01, BM05 and BM06), AD-MSC (AD001, AD002 and AD003) and human foreskin fibroblasts (HFF01, HFF02 and HFF03) at early passage (<5) were harvested with 0.25% trypsin-EDTA (Invitrogen Corporation, Carlsbad, CA) upon reaching 80-90% confluency. About 2-3 x 106 cells from each sample were lysed and total RNA was isolated using the RNAeasy kit (Qiagen Hamburg GmbH, Hamburg, Germany) according to the manufacturer's protocol. The extracted RNA was quantified by reading the absorbance at 260 nm, and its purity was evaluated from the 260/280 ratio of absorbance with NanoDropTM 1000 (Thermo Fisher Scientific Inc). The total RNA integrity was evaluated using the Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA).
Gene expression profiling by microarray experiments
Genome-wide expression profiles of all the samples were analyzed using Agilent SurePrint G3 8x60K arrays (Agilent Technologies, Santa Clara, CA) that combined both coding and long intergenic non-coding RNA (lincRNA) for human genome. Prior to Cy3 labeling, 2uL of Agilent One-Color Spike Mix dilution was added to 100ng of total RNA for each sample. The total RNA was converted to cDNA and then to Cy3-labeled cRNA using Agilent One-Color RNA Spike-In Kit as per the manufacturer's protocol. The labeled cRNA was purified and quantitated prior to hybridization in hybridization oven at 65°C for 17 hr.
Microarray image and data analysis
Microarray image analysis was done using Feature Extraction version 10.7 and data analysis was done by using GeneSpring 11.5 (both from Agilent Technologies, Santa Clara, CA). The threshold was set to intensity value of 1.0. Normalization was done by 75 percentile shift. Baseline transformation was based on the median of samples. The data were further filtered by probeset on flags and expression less than 20. The data has been deposited in Gene Expression Omnibus (GEO) with accession number GSE38947. Unpaired Student's t test was used for statistical analysis. Genes up or downregulated by two-fold change were selected for further analysis. The false discovery rate (FDR) of 5% was estimated with the Benjamini-Hochberg method.
The gene expression profile of LS-FBS and LS-matrigel was compared. LS-FBS were chosen for the subsequent comparisons to other lineages. Hierarchical clustering was performed for LS-FBS versus BM-MSC, AD-MSC and HFF using Pearson Centered and Average-linkage clustering algorithm. Venn diagrams were drawn for the genes upregulated or downregulated in LS-FBS as compared to other lineages. Gene Ontology (GO) analysis was carried out for the upregulated genes and downregulated genes. Significant pathway analysis was also performed wherever possible. Gene functional classification was further carried out by DAVID software [40].
Real time RT-PCR
First strand cDNA was synthesized with Transcriptor First Strand cDNA synthesis kit (Roche Applied Science, Nonnenwald, Penzberg, Germany) as per manufacturer's protocol. Then, quantitative real time polymerase chain reaction (RT-PCR) was performed by using a LightCycler instrument (Roche Diagnostics, Nonnenwald, Penzberg, Germany). Primers for the panel of genes used in this study are listed in Table 1. Products of PCR amplification were detected through intercalation of the SYBR green dye from LightCycler FastStart DNA Master SYBR Green 1 kit (Roche Diagnostics, Nonnenwald, Penzberg, Germany). The amplification cycles were as follows: 95°C for 10 min, followed by 45 cycles at 95°C for 15 s, 62°C for 5 s and 72°C for 20 s. The concentration of MgCl2 in all cycling reactions was 2.4 mM. Gene specific products were confirmed by melting curve analysis. Expression of the genes was normalized with the expression of GAPDH and the expression ratio was calculated by REST software [41].
Gene | Accession | Sense primer | Antisense primer | Product |
GAPDH | NM_002046 | GCCAAGGTCATCCATGACAAC | GTCCACCACCCTGTTGCTGTA | 498 |
SCIN | NM_033128 | ATGGCTTCGGGAAAGTTTATGT | CATCCACCATATTGTGCTGGG | 117 |
RRAGD | NM_021244 | CTAGCGGACTACGGAGACG | ATGAGCAGGATTCTCGGCTTC | 122 |
FABP3 | NM_004102 | ATGGGGACATTCTCACCCTAAA | GCTGTTGTCTCATCGAACTCCA | 91 |
TFAP2B | NM_003221 | TTCCTCCCAAATCGGTGACTT | CGCCGGTGTTGACAGACAT | 75 |
GPNMB | NM_001005340 | CTTCTGCTTACATGAGGGAGC | GGCTGGTGAGTCACTGGTC | 164 |
SFRP1 | NM_003012 | ACGTGGGCTACAAGAAGATGG | CAGCGACACGGGTAGATGG | 184 |
Table 1: Human primer sequences used for real time RT-PCR.
Cell culture
The LS cells were established from corneoscleral rim tissues and cultured in two different conditions as mentioned in the methods. Cell outgrowths were observed after a few days of plating and the cells reached confluence in about 2-3 weeks. The LS cells appeared to be fibroblastic, elongated and spindle shape growing pattern (Figure 1A). LS-matrigel cells have more elongated feature compared to LS-FBS. The LS-matrigel cells could be cultured up to 10 passages or more. The LS cells derived from the samples using both methods were used in the subsequent experiments. The BM-MSC, AD-MSC and HFF showed spindle and fibroblastic morphology when cultured and expanded (Figures 1B-1D).
Gene expression profiling
A total of 871 entities were found upregulated in LS-matrigel compared to LS-FBS (p<0.05, fold change ≥2). The differentially expressed genes (fold change >10) of LS-matrigel versus LSFBS are depicted in Table 2. Hierarchical cluster analysis was performed to determine the relationship of the four different cell types (LS-FBS, BM-MSC, AD-MSC and HFF). The dendrogram in Figure 2 demonstrates that MSC isolated from the same source were clustered together. A total of 340 significant differentially expressed genes (p <0.05, fold change ≥2) were identified between LS-FBS and BM-MSC. Whereas, 399 and 146 differentially expressed genes were identified for AD-MSC and HFF when compared to LS-FBS respectively.
ADAMTS8 | ADAM metallopeptidase with thrombospondin type 1 motif, 8 | NM_007037 | 14.913507 | |
ADRA2A | adrenergic, alpha-2A-, receptor | NM_000681 | 47.013718 | |
ANGPTL4 | angiopoietin-like 4 | NM_139314 | 424.33313 | |
ANGPTL7 | angiopoietin-like 7 | NM_021146 | 14.670821 | |
ANK3 | ankyrin 3, node of Ranvier (ankyrin G) | NM_020987 | 14.409806 | |
APCDD1 | adenomatosis polyposis coli down-regulated 1 | NM_153000 | 11.659266 | |
APOD | apolipoprotein D | NM_001647 | 12.362466 | |
AQP3 | aquaporin 3 (Gill blood group) | NM_004925 | 25.748945 | |
ARHGAP28 | Rho GTPase activating protein 28 | NM_001010000 | 11.816478 | |
ASCL2 | achaete-scute complex homolog 2 (Drosophila) | NM_005170 | 11.49502 | |
CACNA2D3 | calcium channel, voltage-dependent, alpha 2/delta subunit 3 | NM_018398 | 12.480957 | |
CFI | complement factor I | NM_000204 | 12.210217 | |
CILP | cartilage intermediate layer protein, nucleotide pyrophosphohydrolase | NM_003613 | 12.177848 | |
CLCA2 | chloride channel accessory 2 | NM_006536 | 26.598017 | |
COL15A1 | collagen, type XV, alpha 1 | NM_001855 | 22.379642 | |
COL21A1 | collagen, type XXI, alpha 1 | NM_030820 | 48.873936 | |
COL3A1 | collagen, type III, alpha 1 | NM_000090 | 17.54856 | |
COL4A6 | collagen, type IV, alpha 6 | NM_033641 | 12.459421 | |
COL5A1 | collagen, type V, alpha 1 | NM_000093 | 10.208904 | |
COMP | cartilage oligomeric matrix protein | NM_000095 | 23.414925 | |
CPZ | carboxypeptidase Z | NM_001014448 | 21.976519 | |
EGFL6 | EGF-like-domain, multiple 6 | NM_001167890 | 73.905075 | |
FAM65B | family with sequence similarity 65, member B | NM_014722 | 16.607714 | |
FGF18 | fibroblast growth factor 18 | NM_003862 | 15.78104 | |
FOSB | FBJ murine osteosarcoma viral oncogene homolog B | NM_006732 | 13.191734 | |
GABRE | gamma-aminobutyric acid (GABA) A receptor, epsilon | NM_004961 | 11.908827 | |
GADL1 | glutamate decarboxylase-like 1 | NM_207359 | 38.765053 | |
GAP43 | growth associated protein 43 | NM_002045 | 27.63465 | |
H19 | H19, imprinted maternally expressed transcript (non-protein coding) | NR_002196 | 42.17927 | |
HGF | hepatocyte growth factor (hepapoietin A; scatter factor) | NM_001010931 | 13.644942 | |
HTRA3 | HtrA serine peptidase 3 | NM_053044 | 11.428729 | |
IGSF10 | immunoglobulin superfamily, member 10 | NM_178822 | 27.802753 | |
IRF4 | interferon regulatory factor 4 | NM_002460 | 15.386851 | |
LOC100506700 | hypothetical LOC100506700 | XR_110229 | 24.45396 | |
LRRC17 | leucine rich repeat containing 17 | NM_001031692 | 26.013319 | |
LRRC17 | leucine rich repeat containing 17 | NM_005824 | 23.40266 | |
LSP1 | lymphocyte-specific protein 1 | NM_001013254 | 80.217 | |
MFAP4 | microfibrillar-associated protein 4 | NM_002404 | 10.018822 | |
MGP | matrix Gla protein | NM_000900 | 33.745953 | |
MIAT | myocardial infarction associated transcript (non-protein coding) | NR_003491 | 23.861937 | |
MMP27 | matrix metallopeptidase 27 | NM_022122 | 35.801075 | |
N/A | lincRNA:chr22:27053483-27072438 forward strand | N/A | 31.898119 | |
N/A | lincRNA:chr17:67547498-67549996 forward strand | N/A | 23.818346 | |
N/A | lincRNA:chr12:46826133-46974783 forward strand | N/A | 23.46723 | |
N/A | lincRNA:chr22:27065125-27066565 forward strand | N/A | 13.99885 | |
N/A | lincRNA:chr2:74193717-74210392 reverse strand | N/A | 11.909513 | |
N/A | lincRNA:chr2:179803305-179829380 reverse strand | N/A | 10.683858 | |
N/A | lincRNA:chr22:27066072-27067126 forward strand | N/A | 10.115315 | |
NDNF | neuron-derived neurotrophic factor | NM_024574 | 10.847972 | |
OGN | osteoglycin | NM_033014 | 158.96016 | |
OMD | osteomodulin | NM_005014 | 20.503307 | |
OSR2 | odd-skipped related 2 (Drosophila) | NM_053001 | 10.601532 | |
PCOLCE2 | procollagen C-endopeptidase enhancer 2 | NM_013363 | 12.823184 | |
PDGFD | platelet derived growth factor D | NM_025208 | 41.041542 | |
PDK4 | pyruvate dehydrogenase kinase, isozyme 4 | NM_002612 | 13.998885 | |
PGA3 | pepsinogen 3, group I (pepsinogen A) | NM_001079807 | 34.137875 | |
RARRES1 | retinoic acid receptor responder (tazarotene induced) 1 | NM_002888 | 19.60683 | |
RASSF2 | Ras association (RalGDS/AF-6) domain family member 2 | NM_014737 | 12.719816 | |
SORCS2 | sortilin-related VPS10 domain containing receptor 2 | NM_020777 | 16.55429 | |
STRA6 | stimulated by retinoic acid gene 6 homolog (mouse) | NM_001199042 | 13.068887 | |
TDRD6 | tudor domain containing 6 | NM_001010870 | 12.645858 | |
THBS4 | thrombospondin 4 | NM_003248 | 42.90762 | |
TMEM26 | transmembrane protein 26 | NM_178505 | 22.539011 | |
TRIL | TLR4 interactor with leucine-rich repeats | NM_014817 | 29.37157 | |
TXNIP | thioredoxin interacting protein | NM_006472 | 17.168047 | |
WNT2 | wingless-type MMTV integration site family member 2 | NM_003391 | 49.876865 | |
N/A | PREDICTED: Homo sapiens hypothetical LOC729420 (LOC729420), miscRNA [XR_110129] | XR_110129 | 10.492821 | |
N/A | MGC13nov.3.1.L1.1.G04.F.1 NIH_MGC_331 Homo sapiens cDNA clone MGC13nov.3.1.L1.1.G04, mRNA sequence [EG328730] | EG328730 | 10.060941 | |
N/A | PREDICTED: Homo sapiens FLJ46836 protein (FLJ46836), miscRNA [XR_108962] | XR_108962 | 10.016423 | |
Table 2 : Differentially expressed genes in limbal stromal cells cultured in matrigel system versus non-matrigel system supplemented with fetal bovine serum.
In this study, we compared the gene expression of stromal cells derived from different sources namely limbal stromal cells (LS-FBS and LS-matrigel), bone marrow mesenchymal stem cells (BM-MSC), adipose-derived mesenchymal stem cells (ADMSC) and human foreskin fibroblasts (HFF). Morphologically, these cells resembled the fibroblasts with a slight difference in their size and shape. The MSCs derived from various sources are known for their multipotential differentiation towards adipocytes, osteocytes and chondrocytes [42-44]. However, they differ in terms of growth factor, cytokine secretion and immunomodulatory properties [45].
The LS-FBS and LS-matrigel have different molecular signatures despite sharing some common genes that are highly expressed compared to other MSC as shown in Tables 2 and 5 and Appendix 3, 4 and 5. Most of the differentially expressed genes in LS-matrigel are involved in the extracellular components such as collagen, type XXI, alpha 1 (COL21A1), matrix metallopeptidase 27 (MMP27), cartilage oligomeric matrix protein (COMP), collagen, type XV, alpha 1 (COL15A1), collagen, type III, alpha 1 (COL3A1), collagen type IV, alpha 6 (COL4A6) and collagen type V, alpha 1 (COL5A1). The results demonstrated that when LS cells were cultured with FBS without matrigel, the expression of these matrix proteins was downregulated. The matrigel provided an efficient culture microenvironment supporting the production of ECM. Our findings concurred with others that culturing method can have influence on the gene expression profile of stem cells [46]. Higher expression of ECM proteins in LS-matrigel as compared to LS-FBS might mimic the stem cell niche environment for LS cells and might be useful in the maintenance of the limbal epithelial stem cells. Different culture conditions have effect on cell characteristic and gene expression. We believe this maybe an adaptive response to stimuli during damage or pathogenesis of limbal epithelial stem cell niche. Due to this adaptive response, LS cells may generate necessary paracrine factors and ECM proteins to help in recovery process.In addition, LIF has been reported to play a role in self renewal and differentiation of human and mouse stem cells [47]. Murine embryonic stem cells for instance depend strictly on LIF for self renewal and maintenance of pluripotency but LIF is not able to maintain human embryonic stem cells. However, our result showed that both LIF and matrigel were not able to induce pluripotency of the SSEA-4+ LS cells.
Although cell culture conditions, growth factors and even FBS affect the gene expression of the cultured cells, there is still no standard culture protocol for MSC derived from various sources. The characteristics of MSC are always confirmed by immunophenotyping and differentiation assay towards adipocytes, osteocytes and chondrocytes [30]. However, the ex vivo expanded MSC are normally heterogenous. Therefore, a systematic ex vivo global molecular characterization of MSC is needed in the future to define MSC. Thus, gene expression profiling provides an important tool for comparison and characterization of stromal cells from various sources.
In this study, LS-FBS and LS-matrigel were compared to BMMSC, AD-MSC and HFF cultured in FBS. This study demonstrates a set of novel differentially expressed genes in LS-FBS compared to BM-MSC, AD-MSC and HFF. We also found different set of common genes that were highly expressed by LS-matrigel compared to BM-MSC, AD-MSC and HFF cultured in FBS. This might be due to the culture media components such as LIF, bFGF and matrigel. For LS-FBS, the highest expressed gene, SCIN is a Ca2+-dependent actin severing and capping protein [48] which is presumed to regulate exocytosis by affecting the organization of the microfilament network underneath the plasma membrane. This may play an important role in secretion of various growth factors required for maintenance and self renewal of LESC. It also regulates chondrocytes proliferation and differentiation. The second highly expressed gene, Ras-related GTP binding D is a monomeric guanine nucleotide-binding protein, or G protein. The G proteins act as molecular switches in numerous cell processes and signaling pathways (supplied by OMIM). The intracellular fatty acid binding protein 3 (FABP3) is another highly expressed gene in LS cells. The fatty acid binding proteins (FABP) belong to a multigene family. FABP are thought to participate in the uptake, intracellular metabolism and/or transport of longchain fatty acids. They might be responsible in regulating cell growth and proliferation. One of the FABP genes, FABP4 has been reported to be upregulated during adipogenesis of MSC [31,49].
We report a novel set of genes that are consistently highly expressed in LS cells compared to the bone marrow MSC, adipose-derived MSCs and foreskin fibroblasts. The LS cells have unique molecular signature compared to other MSC lineages. Thus, the highly upregulated genes in LS cells could be used as biomarkers by using real time RT-PCR which is less labourious and quicker as compared to microarray analysis. The knowledge gained can help us to improve our understanding of the cellular signaling pathways involved in LESC self-renewal, survival and differentiation, and may aid in the development of strategies to improve the tissue regeneration potential of these cells.
Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.
Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.
Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.
Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.
We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.
The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.
Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.
Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.
Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.
Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.
Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.
This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.
Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.
As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.
Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.
International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.
Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.
Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.
I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!
"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".
I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.
We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.
I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.
I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.
I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.
Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.
“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.
Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.
Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.
Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.
The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.
Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.
Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, The review process for the article “The Handling of Anti-aggregants and Anticoagulants in the Oncologic Heart Patient Submitted to Surgery” was extremely rigorous and detailed. From the initial submission to the final acceptance, the editorial team at the “Journal of Clinical Cardiology and Cardiovascular Interventions” demonstrated a high level of professionalism and dedication. The reviewers provided constructive and detailed feedback, which was essential for improving the quality of our work. Communication was always clear and efficient, ensuring that all our questions were promptly addressed. The quality of the “Journal of Clinical Cardiology and Cardiovascular Interventions” is undeniable. It is a peer-reviewed, open-access publication dedicated exclusively to disseminating high-quality research in the field of clinical cardiology and cardiovascular interventions. The journal's impact factor is currently under evaluation, and it is indexed in reputable databases, which further reinforces its credibility and relevance in the scientific field. I highly recommend this journal to researchers looking for a reputable platform to publish their studies.
Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”
Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner
My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.
My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.
My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.
