AUCTORES
Research article | DOI: https://doi.org/10.31579/2693-4779/132
Medical Genetics-Harvard University. Director of the Division of Medical Genetics and Molecular Optogenetic Research.Division of Medical Genetics and Molecular Pathology Research, Harvard University, Boston Children's Hospital, USA.
*Corresponding Author: Shahin Asadi, Medical Genetics-Harvard University. Director of the Division of Medical Genetics and Molecular Optogenetic Research. Division of Medical Genetics and Molecular Pathology Research, Harvard University, Boston Children's Hospital, USA.
Citation: Shahin Asadi, Seyyed S Mohammad Reza Miremadi, (2023), The Role of Genetic Mutations on Gene MYT1 Polymorphism (rs2273455) in Bipolar & Borderline Personality Disorder, Clinical Research and Clinical Trials. 7(3) ; DOI :10.31579/2693-4779/132
Copyright: © 2023, Shahin Asadi.,This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Received: 26 April 2023 | Accepted: 05 May 2023 | Published: 12 May 2023
Keywords: bipolar disorder; borderline personality disorder; bio psychological disorder; MYT1 gene; mutation
Bipolar disorder is a mood disorder that can cause extreme mood swings: at times you may be extremely "high", euphoric, irritable or energetic. This is called an episode of madness. At other times, you may feel "down," sad, apathetic, or hopeless. Cyclothymic disorder or cyclothymia also includes hypomanic and depressive symptoms. But they are not as severe and prolonged as hypomanic or depressive episodes. These symptoms usually last for at least two years in adults and one year in children and adolescents.
An introduction to bipolar disorder and borderline personality disorder
Bipolar disorder is a mood disorder that can cause extreme mood swings: at times you may be extremely "high", euphoric, irritable or energetic. This is called an episode of madness. At other times, you may feel "down," sad, apathetic, or hopeless. This part is called depression. You may have depression and anxiety symptoms together. This is called a mixed part. Along with mood swings, bipolar disorder causes changes in behavior, energy levels, and activity levels. Bipolar disorder used to be called other names, including manic depression and depressive disorder [1].
There are three types of bipolar disorder: Bipolar I involves manic episodes that last at least 7 days or manic symptoms are so severe that you need immediate hospital care. Depressive episodes are also common. These often last at least two weeks. This type of bipolar disorder can include different parts [1].
Bipolar II disorder includes episodes of depression. But instead of full-blown manic episodes, there are hypomanic episodes. Hypomania is a milder version of mania [1].
Cyclothymic disorder or cyclothymia also includes hypomanic and depressive symptoms. But they are not as severe and prolonged as hypomanic or depressive episodes. These symptoms usually last for at least two years in adults and one year in children and adolescents. With either type, having four or more manic or depressive episodes in a year is called "rapid cycling" [1].
The exact cause of bipolar disorder is unknown. Several factors are likely to contribute to this disorder. They include your genetics, brain structure and function, and your environment. You are at higher risk for bipolar disorder if you have a close relative with it. Going through trauma or stressful life events may further increase this risk. Symptoms of bipolar disorder can vary. But it includes mood swings known as mood episodes: symptoms of an episode can be mania, feeling very high, high or euphoric, feeling jumpy or wired, being more active than usual, having a very short or very short temper. seem irritable, have racing thoughts and talk very fast, need less sleep, feel unusually important, talented, or powerful, do risky things that show poor judgment, such as eating and drinking too much, spending or giving away too much money, or reckless sex [2].
Symptoms of an episode of depression can include feelings of sadness, hopelessness and worthlessness, feeling alone or disconnected from others, speaking too quietly, feeling like you have nothing to say or have forgotten a lot, having low energy, sleeping too much, eating too much or too little, not being interested in your usual activities and not even being able to do simple things, thinking about death or suicide [2].
Symptoms of a mixed episode include both manic and depressive symptoms. For example, you may be very sad, empty, or hopeless, while at the same time having a lot of energy. Some people with bipolar disorder may have milder symptoms. For example, you may experience hypomania instead of mania. With hypomania, you may feel great and find that you can do a lot. You may not feel that anything is wrong. But your family and friends may notice changes in your mood and activity level. They may notice that your behavior is unusual for you. After hypomania, you may experience severe depression [2].
Borderline personality disorder is a mental health disorder that affects the way you think and feel about yourself and others, causing problems in everyday life. This includes self-image issues, difficulty managing emotions and behavior, and a pattern of unstable relationship [2].
With borderline personality disorder, you have a strong fear of abandonment or instability and find it difficult to tolerate being alone. However, inappropriate anger, impulsiveness, and frequent mood swings may push others away, even if you want to have loving and lasting relationships. Borderline personality disorder usually begins in early adulthood. The condition appears to be worse in younger adulthood and may gradually improve with age. If you have borderline personality disorder, don't be discouraged. Many people with this disorder get better with treatment over time and can learn to live a fulfilling life [3].
Borderline personality disorder affects how you feel about yourself, how you relate to others, and how you behave [3].
Signs and symptoms may include:
Intense fear of abandonment, even going to extreme lengths to avoid actual separation or rejection, or imagining a pattern of intensely unstable relationships, such as idealizing someone at one point and then suddenly believing the person does not care enough or is cruel. Rapid changes in identity and self-image that include changing goals and values, and seeing yourself as bad or as if you don't exist at all [3].
Episodes of stress-related paranoia and disconnection from reality last from minutes to hours. Impulsive and risky behaviors, such as gambling, reckless driving, unsafe sex, binge eating or drug abuse, or successful sabotage by abruptly quitting a good job or ending a positive relationship. Threats of suicide or behavior or self-harm, often in response to fear of separation or rejection. Widespread mood swings lasting from hours to days, which can include extreme happiness, irritability, shame, or anxiety [3].
Constant feeling of emptiness
Inappropriate, intense anger, such as frequent loss of temper, sarcasm or bitterness, or physical aggression. As with other mental health disorders, the causes of borderline personality disorder are not fully understood. In addition to environmental factors—such as a history of child abuse or neglect—BPD may be associated with:
Genetics Some twin and family studies suggest that personality disorders may be inherited or strongly associated with other mental health disorders in family members [4].
Brain abnormalities: Some research has shown changes in certain areas of the brain that play a role in regulating emotions, impulsivity, and aggression. In addition, certain brain chemicals that help regulate mood, such as serotonin, may not function properly [4].
risk factors:
Certain factors related to personality development can increase the risk of developing borderline personality disorder. This includes: Hereditary predisposition: If someone close to you - your mother, father, brother or sister - has the same or a similar disorder, you may be at higher risk [4].
Stressful Childhood: Many people with this disorder report being sexually or physically abused or neglected as children. Some people have lost or become estranged from a parent or close caregiver at a young age or have a parent or guardian through substance abuse or other mental health issues. Others have been subject to hostile conflict and unstable family relationships [4].
Complications of borderline personality disorder
Borderline personality disorder can affect many areas of your life. It can negatively affect intimate relationships, work, school, social activities, and self-image, resulting in:
Frequent job changes or loss
Failure to complete education
Several legal cases, such as prison time
Relationships full of conflict, marital stress or divorce
Self-injury, such as cuts or burns, and frequent hospitalizations
Involvement in abusive relationships
Unplanned pregnancies, sexually transmitted infections, motor vehicle accidents and physical altercations due to impulsive and high-risk behaviors, attempted or completed suicide.
In addition, you may have other mental health disorders such as: depression, alcohol or other substance abuse, anxiety disorders, appetite disorders, bipolar disorder, post-traumatic stress disorder (PTSD), attention deficit/hyperactivity disorder (ADHD), other personality disorders [5,6].
In this study, blood samples were taken from 40 people suffering from bipolar disorder, 40 of whom were female and 10 of whom were male and 30 people Health, and with their written consent, molecular genetic testing was performed to check the changes in these genes. Individual information (such as age, gender, medical history) was recorded. The subjects were selected after final diagnosis by a child and adolescent psychiatrist according to DSM-V criteria, signed a written consent for blood sampling, and filled out an interview form designed to understand the contribution of genetic influence. 2 cc of blood was taken from each person and in Falcons containing EDTA as an anticoagulant; It was poured and then the falcons were gently shaken to mix to prevent blood clots from forming. Finally, the samples were stored in a -20 ° C freezer to extract DNA from blood. Saturated salt method was used to extract genomic DNA from whole blood samples. After DNA extraction, its concentration must be determined so that a certain concentration of DNA is subjected to the PCR reaction. In this case, the concentration of DNA used is constantly maintained. Two methods are used to determine the concentration and quality of the extracted DNA.
1- Spectrophotometric method
2- Electrophoresis method
Spectrophotometry is a quantitative method and electrophoresis is a qualitative method. Molecular RFLP-PCR technique was used for this study. This technique is commonly used to examine different alleles of a gene in a population. The sequence diversity of the respective gene alleles creates different cleavage sites for the restriction enzymes, resulting in fragments of different lengths. Depending on the length of the DNA fragments obtained from the cut, the change in nucleotides can be detected. One of the advantages of this method is that it is fast and does not require a probe
Gene | Primer name | Primer Sequenc (5' to 3') | Length (bp) | TM (°C) | Product length(bp) |
MYT1 | Forward Reverse | AGTCAGAATAAGAGGTGGCG TAATGATCATGGCAGCGTCG | 20
20 |
64 |
187 |
Table 1: Specifications of primers used in this study.
Genotype determination: MYT1
To determine the rs2273455 bi-allelic polymorphism, the intron 2 region was amplified by PCR. The characteristics of the primers are given in (Table 2-5), the PCR reaction concentration in (Table 2-6), and the PCR steps in (Table 2-7). PCR products were isolated on 2% agarose gel. Alleles were identified as 187 bp band after staining the gel with safe stain.
Investigation of MYT1 polymorphism (rs2273455) by RFLP method
After PCR reaction using the mentioned primers according to the optimal PCR conditions, a fragment with a length of 187 bp was amplified. To ensure the performance of the PCR reaction for all samples, their PCR products were electrophoresed on 2% agarose gel and stained with Safe stain. PCR products were then cut using Nla III enzyme according to the following steps:
First, all the materials needed for the RFLP reaction, which include double ionized distilled water, a specific buffer of Nla III enzyme, Nla III enzyme, are poured into microtubes containing the PCR product. Then place the microtubes in a pan at 37 ° C for 16 hours. The concentrations of the materials used to break down the Nla III enzyme site are shown in Table 2.
After this period, some of the product containing the enzyme was cut, loaded on agarose gel and electrophoresed. And in the last step, that photo was taken.
Nla III enzyme and its cleavage site
Nla III enzyme is a highly functional restriction enzyme and its cleavage site is as follows:
5 '... G T T C ... 3'
3 ‘... C A A G ... 5’
Reaction material | The final volume in volume 30μl |
ddH2O | 12/5 μl |
Buffer(10x) | 2 μl |
Nla III | 0.5 μl |
PCR Product | 15 μl |
Table 2: Concentration of components used to break down the Nla III enzyme site.
Figure 1: The rs2273455 primer binding site in the MYT1 gene and the Nla III enzyme identification and cleavage site: Arrow indicates the primer forward binding site; Has been).
PCR-RFLP technique was used to investigate this polymorphism. The results of electrophoresis of PCR products related to amplification of rs2273455 polymorphism using appropriate specific primers and fragments of amplification of this polymorphism are shown in Figure 3. PCR fragments contain fragments of length 187 bp and fragments from RFLP-PCR with the effect of Nla III restriction enzyme in the presence of T allele at the enzyme identification site located at the site of the relevant polymorphism; It is cut into two pieces with lengths of 100 and 150 bp and in the presence of C allele it is cut into one piece 250 bp and in the presence of CT allele it is cut into three pieces with lengths of 250, 100 and 150 bp.
In this study, the association of MYT1 rs2273455 polymorphism with RFLP technique was investigated. In this regard, 40 people with Bipolar disorder
and 50 healthy people without a history of Bipolar disorder as a control group in the northwestern region of Iran were studied. The characteristics of the sick and control subjects are given in Tables 3a and 3b. The genotypic distribution of rs2273455 polymorphism was calculated for patients with Bipolar disorder and the control group.
Based on statistical calculations and genotypic distribution between patients and controls, no correlation was found because the calculated P-value for different genotypes is greater than 0.05, which means that the hypothesis of the association of this polymorphism with Bipolar disorder is rejected (0.5 = P-value). The genotypic frequency distribution of rs2273455 polymorphism of MYT1 gene was calculated in the whole patient and control groups.
Figure 2: Image of binding pattern of MYT1 gene in gel electrophoresis by RT-PCR technique.
Figure 2: Image of binding pattern of MYT1 gene in gel electrophoresis by RT-PCR technique and detection of nucleotide base pairs.
Figure 3: Schematic of the nucleotide sequence of MYT1 gene probes.
Bipolar disorder is a mood disorder that can cause extreme mood swings: at times you may be extremely "high", euphoric, irritable or energetic. This is called an episode of madness. At other times, you may feel "down," sad, apathetic, or hopeless. This part is called depression. You may have depression and anxiety symptoms together. Cyclothymic disorder or cyclothymia also includes hypomanic and depressive symptoms. But they are not as severe and prolonged as hypomanic or depressive episodes. These symptoms usually last for at least two years in adults and one year in children and adolescents. With either type, having four or more manic or depressive episodes in a year is called "rapid cycling. Borderline personality disorder is a mental health disorder that affects the way you think and feel about yourself and others, causing problems in everyday life. This includes self-image issues, difficulty managing emotions and behavior, and a pattern of unstable relationships [7-9].
Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.
Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.
Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.
Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.
We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.
The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.
Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.
Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.
Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.
Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.
Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.
This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.
Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.
As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.
Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.
International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.
Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.
Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.
I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!
"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".
I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.
We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.
I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.
I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.
I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.
Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.
“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.
Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.
Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.
Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.
The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.
Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.
Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, The review process for the article “The Handling of Anti-aggregants and Anticoagulants in the Oncologic Heart Patient Submitted to Surgery” was extremely rigorous and detailed. From the initial submission to the final acceptance, the editorial team at the “Journal of Clinical Cardiology and Cardiovascular Interventions” demonstrated a high level of professionalism and dedication. The reviewers provided constructive and detailed feedback, which was essential for improving the quality of our work. Communication was always clear and efficient, ensuring that all our questions were promptly addressed. The quality of the “Journal of Clinical Cardiology and Cardiovascular Interventions” is undeniable. It is a peer-reviewed, open-access publication dedicated exclusively to disseminating high-quality research in the field of clinical cardiology and cardiovascular interventions. The journal's impact factor is currently under evaluation, and it is indexed in reputable databases, which further reinforces its credibility and relevance in the scientific field. I highly recommend this journal to researchers looking for a reputable platform to publish their studies.
Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”
Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner
My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.
My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.
My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.