The Constantly Highly Expression of Limbal Stromal Cells Compared to the Bone Marrow Mesenchymal Stromal Cells, Adipose-Derived Mesenchymal Stromal Cells and Foreskin Fibroblasts

Research Article | DOI: https://doi.org/10.31579/2643-1912/005

The Constantly Highly Expression of Limbal Stromal Cells Compared to the Bone Marrow Mesenchymal Stromal Cells, Adipose-Derived Mesenchymal Stromal Cells and Foreskin Fibroblasts

  • Ampati Srinivas 1*
  • Kokkula Pavan Kumar 2
  • Swathi Chilukala 3

1 Deportment of Medicinal chemistry, Unity College of pharmacy,Bongir, India 
2 Deportment of Pharmacology, Unity College of pharmacy,Bongir, India 
3 Deportment of Pharmaceutics, Unity college of Pharmacy, Bongir India

*Corresponding Author: Ampati Srinivas, Deportment of Medicinal chemistry, Unity College of pharmacy, Bongir, India. E-mail: drampaty@gmail.com

Citation: Ampati Srinivas and Kokkula Pavan Kumar, Differentiation of Human Embryonic Stem Cells into Engrafting Myogenic Precursor Cells. J. Stem cell Research and Therapeutics International, DOI: 10.31579/2643-1912/005

Copyright: © 2019 Ampati Srinivas, This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Received: 21 March 2019 | Accepted: 12 April 2019 | Published: 16 April 2019

Keywords: limbal stromal cells; bone marrow mesenchymal stromal cells; adipose mesenchymal stem cells; gene expression profiling; microarray; limbal epithelial stem cells

Abstract

Limbal epithelial stem cells (LESC) have great potential in treating the blindness caused by corneal damage. LESC are maintained in stem cell niche called Palisade of Vogt. Limbal stromal (LS) cells are critical component of LESC niche and help in their self renewal. These cells resemble mesenchymal stromal/stem cells with multilineage differentiation potential. However little is known about their gene expression profile compared to MSC derived from various sources.

Introduction

Human cornea on the front surface of eye is very critical for vision. The corneal transparency, continuous regeneration and functionality of corneal epithelium play an important role in refraction of light on to the retina. Corneal epithelium is regenerated by unique population of stem cells called limbal epithelial stem cells (LESC) that are located in the basal region of limbus. LESC differ from the corneal epithelium due to the lack of corneo-specific differentiation keratins (K3/K12) expression [1-3], connexin 43-mediated gap junction intercellular communication [4-6], p63 nuclear transcription factor [7,8], cell cycle duration [9], and label retaining property [10]. The limbal stroma provides a unique stem cell niche or microenvironment which is important for the modulation of stemness as it is heavily pigmented, highly innervated and vascularized. Clinically, destruction of LESC or the limbal stromal niche can lead to a pathological stage of LESC deficiency with severe loss of vision [11]. Chronic inflammation in the limbal deficient stroma is sufficient to cause detrimental damage to the conjunctival limbal autograft transplanted to patients or experimental rabbits [12]. These findings suggest that the limbal stromal niche is critical in regulating the self-renewal and the fate of LESC. Although the mechanism remains elusive, modulation of epithelial proliferation, differentiation, proliferation and apoptosis by the limbal stroma has been reported to favor stemness [13]. Limbal stromal (LS) cells are very important component of limbal stromal niche that helps in self renewal of LESC. Recently, LS cells were shown to have multilineage differentiation potential [14-17]. In one of the studies, an ABCG2-expressing FACS sorted side population cells from limbal stroma were able to differentiate into chondrocytes and neurons following differentiation induction [14]. In other studies, multipotent cells were also found in corneal stroma [15] and limbal stroma [16-17]. Earlier, we have reported that an ex vivo expanded LS cells possess multipotent differentiation potential towards adipocytes, osteocytes and chondrocytes [18]. Other stromal cells such as mesenchymal stem/stromal cells (MSC) can also be isolated and expanded in vitro for tissue regeneration applications [19-22]. MSC were first identified from bone marrow aspirates [23,24] and subsequently in Wharton's jelly of human umbilical cords [25], adipose tissue [26], dental tissues [27,28] and skin [29]. Most of the stromal cells derived from various sources expressed the markers of MSCs such as CD44, CD73, CD90, CD105, STRO1 and do not express markers of hematopoietic lineage such as CD14, CD34, CD45 and HLA-DR [30].

In order to find out the specific molecular signature, cellular function and potential biomarkers of the LS cells, we compared the global gene expression profile including long non-coding RNA (lincRNA) of the expanded LS cells with the MSCs derived from bone marrow, adipose tissue and foreskin fibroblasts. In addition, we also evaluated the effects of two different culture conditions on the LS cells gene expression.

Methods

Establishment of limbal stromal cell culture

Corneoscleral rims from three cadaveric donors were obtained from post cornea graft transplantation with informed consent from the donor's relative. The rims were washed with phosphate buffer saline (PBS; Invitrogen Corporation, Carlsbad, CA) and then trimmed to remove the sclera. The limbal tissues were incubated at 37°C for 2 h with dispase (BD Biosciences, Mississauga, Canada) at a concentration of 5 mg/mL. The limbal tissues were then cut into approximately 2 mm explants after washing with PBS. The limbal explants were cultured on matrigel (BD Biosciences, Mississauga, Canada) coated plates with complete medium containing Dulbecco's Modified Eagle's Medium (DMEM)/F12, 10% knockout serum replacement, 10 µg/mL insulin, 5 µg/mL transferrin, 5 µg/mL selenium-X, 100 IU/mL penicillin, 100 µg/mL streptomycin (all from Invitrogen Corporation, Carlsbad, CA, USA), 10 ng/mL leukemia inhibitory factor (LIF) (Sigma-Aldrich Chemic, Steinheim, Germany) and 4 ng/mL basic fibroblast growth factor (bFGF; BD Biosciences, Mississauga, Canada) [17]. The expanded limbal stromal cells were subjected to fluorescenceactivated cells sorting (FACS) for the isolation of stage-specific embryonic antigen 4 (SSEA-4+) cells as reported previously [18]. The sorted SSEA-4+ cells were propagated on matrigel coated plate with the medium as mentioned previously. The limbal stromal cells that were maintained in this matrigel system were named as LS-matrigel. On the other hand, some of the sorted cells were maintained on normal plates with Dulbecco's Modified Eagle's Medium (DMEM)/F12 supplemented with 10% fetal bovine serum (FBS), 100 IU/mL penicillin, 100 µg/mL streptomycin (all from Invitrogen Corporation, Carlsbad, CA, USA). These cells were identified as LS-FBS.

Human bone marrow mesenchymal stromal/stem cells (BM-MSC) culture

Bone marrow MSC from three different lots (Millipore, Billerica, MA) were propagated and cultured according to manufacturer's protocol. Briefly, cells at passage 4 were cultured on 0.1% gelatin coated plates with Mesenchymal Stem Cell Expansion Medium (Millipore, Billerica, MA) supplemented with 8 ng/mL fibroblast growth factor-2 (FGF-2) (Millipore, Billerica, MA). When the cells were approximately 80% confluent, they were dissociated with trypsin-EDTA (Invitrogen Corporation, Carlsbad, CA) and passaged or alternatively frozen for later use.

Human adipose-derived mesenchymal stromal/stem cells (AD-MSC) and human foreskin fibroblast cells (HFF) culture.

Cryopreserved AD-MSC and HFF (n=3) at early passage (2- 3) were obtained from Stempeutics Research Malaysia and propagated in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin and 100 µg/mL streptomycin (all from Invitrogen Corporation, Carlsbad, CA). When the cells were approximately 80% confluent, they were dissociated with trypsin-EDTA (Invitrogen Corporation, Carlsbad, CA) and passaged or alternatively frozen for later use.

Total RNA extraction and quality assessment

LS-FBS (S1-P3, S3-P4 and S6-P3), LS-matrigel (S1-P6, S3-P6 and S6-P5), BM-MSC (BM01, BM05 and BM06), AD-MSC (AD001, AD002 and AD003) and human foreskin fibroblasts (HFF01, HFF02 and HFF03) at early passage (<5) were harvested with 0.25% trypsin-EDTA (Invitrogen Corporation, Carlsbad, CA) upon reaching 80-90% confluency. About 2-3 x 106 cells from each sample were lysed and total RNA was isolated using the RNAeasy kit (Qiagen Hamburg GmbH, Hamburg, Germany) according to the manufacturer's protocol. The extracted RNA was quantified by reading the absorbance at 260 nm, and its purity was evaluated from the 260/280 ratio of absorbance with NanoDropTM 1000 (Thermo Fisher Scientific Inc). The total RNA integrity was evaluated using the Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA).

Gene expression profiling by microarray experiments

Genome-wide expression profiles of all the samples were analyzed using Agilent SurePrint G3 8x60K arrays (Agilent Technologies, Santa Clara, CA) that combined both coding and long intergenic non-coding RNA (lincRNA) for human genome. Prior to Cy3 labeling, 2uL of Agilent One-Color Spike Mix dilution was added to 100ng of total RNA for each sample. The total RNA was converted to cDNA and then to Cy3-labeled cRNA using Agilent One-Color RNA Spike-In Kit as per the manufacturer's protocol. The labeled cRNA was purified and quantitated prior to hybridization in hybridization oven at 65°C for 17 hr.

Microarray image and data analysis

Microarray image analysis was done using Feature Extraction version 10.7 and data analysis was done by using GeneSpring 11.5 (both from Agilent Technologies, Santa Clara, CA). The threshold was set to intensity value of 1.0. Normalization was done by 75 percentile shift. Baseline transformation was based on the median of samples. The data were further filtered by probeset on flags and expression less than 20. The data has been deposited in Gene Expression Omnibus (GEO) with accession number GSE38947. Unpaired Student's t test was used for statistical analysis. Genes up or downregulated by two-fold change were selected for further analysis. The false discovery rate (FDR) of 5% was estimated with the Benjamini-Hochberg method.

The gene expression profile of LS-FBS and LS-matrigel was compared. LS-FBS were chosen for the subsequent comparisons to other lineages. Hierarchical clustering was performed for LS-FBS versus BM-MSC, AD-MSC and HFF using Pearson Centered and Average-linkage clustering algorithm. Venn diagrams were drawn for the genes upregulated or downregulated in LS-FBS as compared to other lineages. Gene Ontology (GO) analysis was carried out for the upregulated genes and downregulated genes. Significant pathway analysis was also performed wherever possible. Gene functional classification was further carried out by DAVID software [40].

Real time RT-PCR

First strand cDNA was synthesized with Transcriptor First Strand cDNA synthesis kit (Roche Applied Science, Nonnenwald, Penzberg, Germany) as per manufacturer's protocol. Then, quantitative real time polymerase chain reaction (RT-PCR) was performed by using a LightCycler instrument (Roche Diagnostics, Nonnenwald, Penzberg, Germany). Primers for the panel of genes used in this study are listed in Table 1. Products of PCR amplification were detected through intercalation of the SYBR green dye from LightCycler FastStart DNA Master SYBR Green 1 kit (Roche Diagnostics, Nonnenwald, Penzberg, Germany). The amplification cycles were as follows: 95°C for 10 min, followed by 45 cycles at 95°C for 15 s, 62°C for 5 s and 72°C for 20 s. The concentration of MgCl2 in all cycling reactions was 2.4 mM. Gene specific products were confirmed by melting curve analysis. Expression of the genes was normalized with the expression of GAPDH and the expression ratio was calculated by REST software [41].

Gene

Accession

Sense primer

Antisense primer

Product
Size (bp)

GAPDH

NM_002046

GCCAAGGTCATCCATGACAAC

GTCCACCACCCTGTTGCTGTA

498

SCIN

NM_033128

ATGGCTTCGGGAAAGTTTATGT

CATCCACCATATTGTGCTGGG

117

RRAGD

NM_021244

CTAGCGGACTACGGAGACG

ATGAGCAGGATTCTCGGCTTC

122

FABP3

NM_004102

ATGGGGACATTCTCACCCTAAA

GCTGTTGTCTCATCGAACTCCA

   91

TFAP2B

NM_003221

TTCCTCCCAAATCGGTGACTT

CGCCGGTGTTGACAGACAT

   75

GPNMB

NM_001005340

CTTCTGCTTACATGAGGGAGC

GGCTGGTGAGTCACTGGTC

164

SFRP1

NM_003012

ACGTGGGCTACAAGAAGATGG

CAGCGACACGGGTAGATGG

184


Table 1: Human primer sequences used for real time RT-PCR.

Results

Cell culture

The LS cells were established from corneoscleral rim tissues and cultured in two different conditions as mentioned in the methods. Cell outgrowths were observed after a few days of plating and the cells reached confluence in about 2-3 weeks. The LS cells appeared to be fibroblastic, elongated and spindle shape growing pattern (Figure 1A). LS-matrigel cells have more elongated feature compared to LS-FBS. The LS-matrigel cells could be cultured up to 10 passages or more. The LS cells derived from the samples using both methods were used in the subsequent experiments. The BM-MSC, AD-MSC and HFF showed spindle and fibroblastic morphology when cultured and expanded (Figures 1B-1D).

 

https://auctoresonline.org/beta/uploads/articles/external/0-13417600-1625906600.png
Figure 1: Morphological observations.

Gene expression profiling

A total of 871 entities were found upregulated in LS-matrigel compared to LS-FBS (p<0.05, fold change ≥2). The differentially expressed genes (fold change >10) of LS-matrigel versus LSFBS are depicted in Table 2. Hierarchical cluster analysis was performed to determine the relationship of the four different cell types (LS-FBS, BM-MSC, AD-MSC and HFF). The dendrogram in Figure 2 demonstrates that MSC isolated from the same source were clustered together. A total of 340 significant differentially expressed genes (p <0.05, fold change ≥2) were identified between LS-FBS and BM-MSC. Whereas, 399 and 146 differentially expressed genes were identified for AD-MSC and HFF when compared to LS-FBS respectively.
 

https://auctoresonline.org/beta/uploads/articles/external/0-76932900-1625906600.png
Figure 2: Hierarchical clustering of all the samples from different sources.


 

https://auctoresonline.org/beta/uploads/articles/external/0-02672800-1625906601.png
Figure 3: Venn diagrams showing the numbers of all up- (panel A) or downregulated genes (panel B) of LS-FBS when compared to BM-MSC (bone marrow mesenchymal stem cells), AD-MSC (adipose-derived mesenchymal stem cells) and HFF (human foreskin fibroblasts).

 

ADAMTS8

ADAM metallopeptidase with thrombospondin type 1 motif, 8

NM_007037

14.913507

ADRA2A

adrenergic, alpha-2A-, receptor

NM_000681

47.013718

ANGPTL4

angiopoietin-like 4

NM_139314

424.33313

ANGPTL7

angiopoietin-like 7

NM_021146

14.670821

ANK3

ankyrin 3, node of Ranvier (ankyrin G)

NM_020987

14.409806

APCDD1

adenomatosis polyposis coli down-regulated 1

NM_153000

11.659266

APOD

apolipoprotein D

NM_001647

12.362466

AQP3

aquaporin 3 (Gill blood group)

NM_004925

25.748945

ARHGAP28

Rho GTPase activating protein 28

NM_001010000

11.816478

ASCL2

achaete-scute complex homolog 2 (Drosophila)

NM_005170

11.49502

CACNA2D3

calcium channel, voltage-dependent, alpha 2/delta subunit 3

NM_018398

12.480957

CFI

complement factor I

NM_000204

12.210217

CILP

cartilage intermediate layer protein, nucleotide pyrophosphohydrolase

NM_003613

12.177848

CLCA2

chloride channel accessory 2

NM_006536

26.598017

COL15A1

collagen, type XV, alpha 1

NM_001855

22.379642

COL21A1

collagen, type XXI, alpha 1

NM_030820

48.873936

COL3A1

collagen, type III, alpha 1

NM_000090

17.54856

COL4A6

collagen, type IV, alpha 6

NM_033641

12.459421

COL5A1

collagen, type V, alpha 1

NM_000093

10.208904

COMP

cartilage oligomeric matrix protein

NM_000095

23.414925

CPZ

carboxypeptidase Z

NM_001014448

21.976519

EGFL6

EGF-like-domain, multiple 6

NM_001167890

73.905075

FAM65B

family with sequence similarity 65, member B

NM_014722

16.607714

FGF18

fibroblast growth factor 18

NM_003862

15.78104

FOSB

FBJ murine osteosarcoma viral oncogene homolog B

NM_006732

13.191734

GABRE

gamma-aminobutyric acid (GABA) A receptor, epsilon

NM_004961

11.908827

GADL1

glutamate decarboxylase-like 1

NM_207359

38.765053

GAP43

growth associated protein 43

NM_002045

27.63465

H19

H19, imprinted maternally expressed transcript (non-protein coding)

NR_002196

42.17927

HGF

hepatocyte growth factor (hepapoietin A; scatter factor)

NM_001010931

13.644942

HTRA3

HtrA serine peptidase 3

NM_053044

11.428729

IGSF10

immunoglobulin superfamily, member 10

NM_178822

27.802753

IRF4

interferon regulatory factor 4

NM_002460

15.386851

LOC100506700

hypothetical LOC100506700

XR_110229

24.45396

LRRC17

leucine rich repeat containing 17

NM_001031692

26.013319

LRRC17

leucine rich repeat containing 17

NM_005824

23.40266

LSP1

lymphocyte-specific protein 1

NM_001013254

80.217

MFAP4

microfibrillar-associated protein 4

NM_002404

10.018822

MGP

matrix Gla protein

NM_000900

33.745953

MIAT

myocardial infarction associated transcript (non-protein coding)

NR_003491

23.861937

MMP27

matrix metallopeptidase 27

NM_022122

35.801075

N/A

lincRNA:chr22:27053483-27072438 forward strand

N/A

31.898119

N/A

lincRNA:chr17:67547498-67549996 forward strand

N/A

23.818346

N/A

lincRNA:chr12:46826133-46974783 forward strand

N/A

23.46723

N/A

lincRNA:chr22:27065125-27066565 forward strand

N/A

13.99885

N/A

lincRNA:chr2:74193717-74210392 reverse strand

N/A

11.909513

N/A

lincRNA:chr2:179803305-179829380 reverse strand

N/A

10.683858

N/A

lincRNA:chr22:27066072-27067126 forward strand

N/A

10.115315

NDNF

neuron-derived neurotrophic factor

NM_024574

10.847972

OGN

osteoglycin

NM_033014

158.96016

OMD

osteomodulin

NM_005014

20.503307

OSR2

odd-skipped related 2 (Drosophila)

NM_053001

10.601532

PCOLCE2

procollagen C-endopeptidase enhancer 2

NM_013363

12.823184

PDGFD

platelet derived growth factor D

NM_025208

41.041542

PDK4

pyruvate dehydrogenase kinase, isozyme 4

NM_002612

13.998885

PGA3

pepsinogen 3, group I (pepsinogen A)

NM_001079807

34.137875

RARRES1

retinoic acid receptor responder (tazarotene induced) 1

NM_002888

19.60683

RASSF2

Ras association (RalGDS/AF-6) domain family member 2

NM_014737

12.719816

SORCS2

sortilin-related VPS10 domain containing receptor 2

NM_020777

16.55429

STRA6

stimulated by retinoic acid gene 6 homolog (mouse)

NM_001199042

13.068887

TDRD6

tudor domain containing 6

NM_001010870

12.645858

THBS4

thrombospondin 4

NM_003248

42.90762

TMEM26

transmembrane protein 26

NM_178505

22.539011

TRIL

TLR4 interactor with leucine-rich repeats

NM_014817

29.37157

TXNIP

thioredoxin interacting protein

NM_006472

17.168047

WNT2

wingless-type MMTV integration site family member 2

NM_003391

49.876865

N/A

PREDICTED: Homo sapiens hypothetical LOC729420 (LOC729420), miscRNA [XR_110129]

XR_110129

10.492821

N/A

MGC13nov.3.1.L1.1.G04.F.1 NIH_MGC_331 Homo sapiens cDNA clone MGC13nov.3.1.L1.1.G04, mRNA sequence [EG328730]

EG328730

10.060941

N/A

PREDICTED: Homo sapiens FLJ46836 protein (FLJ46836), miscRNA [XR_108962]

XR_108962

10.016423

Table 2 : Differentially expressed genes in limbal stromal cells cultured in matrigel system versus non-matrigel system supplemented with fetal bovine serum.

Discussion

In this study, we compared the gene expression of stromal cells derived from different sources namely limbal stromal cells (LS-FBS and LS-matrigel), bone marrow mesenchymal stem cells (BM-MSC), adipose-derived mesenchymal stem cells (ADMSC) and human foreskin fibroblasts (HFF). Morphologically, these cells resembled the fibroblasts with a slight difference in their size and shape. The MSCs derived from various sources are known for their multipotential differentiation towards adipocytes, osteocytes and chondrocytes [42-44]. However, they differ in terms of growth factor, cytokine secretion and immunomodulatory properties [45].

The LS-FBS and LS-matrigel have different molecular signatures despite sharing some common genes that are highly expressed compared to other MSC as shown in Tables 2 and 5 and Appendix 3, 4 and 5. Most of the differentially expressed genes in LS-matrigel are involved in the extracellular components such as collagen, type XXI, alpha 1 (COL21A1), matrix metallopeptidase 27 (MMP27), cartilage oligomeric matrix protein (COMP), collagen, type XV, alpha 1 (COL15A1), collagen, type III, alpha 1 (COL3A1), collagen type IV, alpha 6 (COL4A6) and collagen type V, alpha 1 (COL5A1). The results demonstrated that when LS cells were cultured with FBS without matrigel, the expression of these matrix proteins was downregulated. The matrigel provided an efficient culture microenvironment supporting the production of ECM. Our findings concurred with others that culturing method can have influence on the gene expression profile of stem cells [46]. Higher expression of ECM proteins in LS-matrigel as compared to LS-FBS might mimic the stem cell niche environment for LS cells and might be useful in the maintenance of the limbal epithelial stem cells. Different culture conditions have effect on cell characteristic and gene expression. We believe this maybe an adaptive response to stimuli during damage or pathogenesis of limbal epithelial stem cell niche. Due to this adaptive response, LS cells may generate necessary paracrine factors and ECM proteins to help in recovery process.In addition, LIF has been reported to play a role in self renewal and differentiation of human and mouse stem cells [47]. Murine embryonic stem cells for instance depend strictly on LIF for self renewal and maintenance of pluripotency but LIF is not able to maintain human embryonic stem cells. However, our result showed that both LIF and matrigel were not able to induce pluripotency of the SSEA-4+ LS cells.

Although cell culture conditions, growth factors and even FBS affect the gene expression of the cultured cells, there is still no standard culture protocol for MSC derived from various sources. The characteristics of MSC are always confirmed by immunophenotyping and differentiation assay towards adipocytes, osteocytes and chondrocytes [30]. However, the ex vivo expanded MSC are normally heterogenous. Therefore, a systematic ex vivo global molecular characterization of MSC is needed in the future to define MSC. Thus, gene expression profiling provides an important tool for comparison and characterization of stromal cells from various sources.

In this study, LS-FBS and LS-matrigel were compared to BMMSC, AD-MSC and HFF cultured in FBS. This study demonstrates a set of novel differentially expressed genes in LS-FBS compared to BM-MSC, AD-MSC and HFF. We also found different set of common genes that were highly expressed by LS-matrigel compared to BM-MSC, AD-MSC and HFF cultured in FBS. This might be due to the culture media components such as LIF, bFGF and matrigel. For LS-FBS, the highest expressed gene, SCIN is a Ca2+-dependent actin severing and capping protein [48] which is presumed to regulate exocytosis by affecting the organization of the microfilament network underneath the plasma membrane. This may play an important role in secretion of various growth factors required for maintenance and self renewal of LESC. It also regulates chondrocytes proliferation and differentiation. The second highly expressed gene, Ras-related GTP binding D is a monomeric guanine nucleotide-binding protein, or G protein. The G proteins act as molecular switches in numerous cell processes and signaling pathways (supplied by OMIM). The intracellular fatty acid binding protein 3 (FABP3) is another highly expressed gene in LS cells. The fatty acid binding proteins (FABP) belong to a multigene family. FABP are thought to participate in the uptake, intracellular metabolism and/or transport of longchain fatty acids. They might be responsible in regulating cell growth and proliferation. One of the FABP genes, FABP4 has been reported to be upregulated during adipogenesis of MSC [31,49].

Conclusion

We report a novel set of genes that are consistently highly expressed in LS cells compared to the bone marrow MSC, adipose-derived MSCs and foreskin fibroblasts. The LS cells have unique molecular signature compared to other MSC lineages. Thus, the highly upregulated genes in LS cells could be used as biomarkers by using real time RT-PCR which is less labourious and quicker as compared to microarray analysis. The knowledge gained can help us to improve our understanding of the cellular signaling pathways involved in LESC self-renewal, survival and differentiation, and may aid in the development of strategies to improve the tissue regeneration potential of these cells.

References

Dear Editorial Team, Clinical Medical Reviews and Reports. My experience with the journal was highly positive. The peer-review process was rigorous, constructive, and completed in a timely manner. The reviewers provided valuable comments that helped improve the quality and clarity of our manuscript. The editorial office was professional, responsive, and supportive throughout all stages of the publication process. Communication was clear and efficient, and any questions were addressed promptly. Overall, I found the journal to maintain high scientific standards and an excellent publication workflow. I would be pleased to consider submitting future work to this journal. Best wishes from, Elena Popa.

img

Dr Elena Popa

It was my pleasure to submit my testimonial concerning the Reviewer Board of our Scientific Journal “Brain and Neurological Disorders”. The Reviewers focused on some modifications and their contribution was helpful. The ladies of our Editorial Office were also supported my efforts. It was my honor to have such a co-operation and I am looking forward for more collaboration.

img

Dr Nikolaos Andreas Chrysanthakopoulos

Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Thank you for the speedy and efficient peer review process. I appreciate the fact that your peer reviewers do not take months to respond like with some other journals. I would also like to thank the editorial office for responding quickly to my questions. It is an excellent journal. I plan to submit more manuscripts in the future. Best wishes from, Robert W. McGee

img

Robert W McGee

Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Working with you and your team on our recent publication in JCRR has been a truly wonderful and enjoyable experience. The responses were prompt, and the reviewers were patient, constructive, and highly professional. One reviewer in particular gave me the feeling that a professor was carefully reading and commenting on my coursework, which was deeply touching. The entire process was straightforward and hassle‑free, with no tedious online forms to complete. I highly recommend this journal. Best wishes from, DR Aibing Rao, Head of R&D

img

Aibing Rao

I Appreciate the Opportunity to Share my Experience with the Journal of Clinical Research and Reports. The peer review process was timely and constructive, and the feedback provided helped improve the quality of our manuscript. The editorial office was professional, responsive, and supportive throughout the process, ensuring smooth communication and efficient handling of the submission. Overall, it was a positive experience collaborating with your team.

img

Kashani Mehdi

Dear Mercy Grace, Editorial Coordinator of Obstetrics Gynecology and Reproductive Sciences, We would like to express our gratitude for your help at all stages of publishing and editing the article. The editors of the magazine answer all the necessary questions and help at every stage. We will definitely continue to cooperate and publish other works in the Obstetrics Gynecology and Reproductive Sciences! Best wishes from, Alla Konstantinovna Politova,

img

Alla Konstantinovna Politova

Dear Maria Emerson, Editorial Coordinator of International Journal of Clinical Case Reports and Reviews, What distinguishes International Journal of Clinical Case Report and Review is not only the scientific rigor of its publications, but the intellectual climate in which research is evaluated. The submission process is refreshingly free of unnecessary formal barriers and bureaucratic rituals that often complicate academic publishing without adding real value. The peer-review system is demanding yet constructive, guided by genuine scientific dialogue rather than hierarchical or authoritarian attitudes. Reviewers act as collaborators in improving the manuscript, not as gatekeepers imposing arbitrary standards. This journal offers a rare balance: high methodological standards combined with a respectful, transparent, and supportive editorial approach. In an era where publishing can feel more burdensome than research itself, this platform restores the original purpose of peer review — to refine ideas, not to obstruct them Prof. Perlat Kapisyzi, FCCP PULMONOLOGIST AND THORACIC IMAGING.

img

Perlat Kapisyzi

Dear Reader: We have published several articles in the Auctores Publishing, LLC, journal, Clinical Medical Reviews and Reports in recent years (CMRR). This is an ‘open access’ journal and the following are our observations. From the initial invitation to submit an article, to the final edits of galley proofs, we have found CMRR personnel to be professional, responsive, rapid and thorough. This entire process begins with Catherine Mitchell, Editorial Coordinator. She is simply outstanding, and, I believe, unparalleled in her capacity. I cannot imagine a more responsive and dedicated Editorial Coordinator. As I read the dates and timing of her correspondence with us, it seems that she never sleeps. I hope Auctores Publishing, LLC, appreciates her efforts as much as these authors do. Thank you to Auctores Publishing, LLC, to the Editorial Staff/Board, and to Catherine Mitchell from a grateful author(s).

img

Dr Gary Merrill

Dear Maria Emerson, Editorial Coordinator of - Journal of Clinical Research and Reports. ''I am pleased to provide this testimonial following the publication of our recent case report in this journal. The peer review process was rigorous, constructive, thorough, and conducted in a timely manner. The reviewers’ comments were thoughtful, detailed, and highly constructive, contributing substantially to the refinement, clarity, and scientific robustness of our manuscript. The process was conducted with professionalism and academic integrity throughout. The support provided by the editorial office was exemplary. Communication was consistently prompt, clear, and courteous at all stages of the submission and publication process. The editorial team demonstrated a high level of organization and responsiveness, ensuring that all queries were addressed efficiently and that the process remained transparent and well-coordinated. The overall quality of the journal is reflected in its strong editorial standards, commitment to scientific excellence, and dedication to publishing clinically meaningful research. It has been a privilege to publish our work in this journal, and we would welcome the opportunity to contribute further in the future.'' Best wishes from, Dr. Efstratios Trogkanis, Cardiologist.

img

Dr Efstratios Troganis

Dear Grace Pierce, Editorial Coordinator of the journal IJCCR, I had a very positive experience with Auctores - Journal throughout the publication process. The Editorial Team was highly responsive, professional, and supportive at every stage. I would like to extend my sincere thanks to the Editor: Grace Pierce, for her guidance and assistance. The peer-review process was smooth and constructive, helping improve the quality of my work. I would gladly recommend Auctores Journal to fellow researchers and authors. Dr. SABITA SINHA, Medical Oncologist, MD (Electro Homeopathy).

img

Dr SABITA SINHA

Dear Mayra Duenas, Editorial Coordinator of the journal IJCCR, I write here a little on my experience as an author submitting to the International Journal of Clinical Case Reports and Reviews (IJCCR). This was my first submission to IJCCR and my manuscript was inherently an outsider’s effort. It attempted to broadly identify and then make some sense of life’s under-appreciated mysteries. I initially had responded to a request for possible submissions. I then contacted IJCCR with a tentative topic for a manuscript. They quickly got back with an approval for the submission, but with a particular requirement that it be medically relevant. I then put together a manuscript and submitted it. After the usual back-and-forth over forms and formality, the manuscript was sent off for reviews. Within 2 weeks I got back 4 reviews which were both helpful and also surprising. Surprising in that the topic was somewhat foreign to medical literature. My subsequent updates in response to the reviewer comments went smoothly and in short order I had a series of proofs to evaluate. All in all, the whole publication process seemed outstanding. It was both helpful in terms of the paper’s content and also in terms of its efficient and friendly communications. Thank you all very much. Sincerely, Ted Christopher, Rochester, NY.

img

Dr Ted Christopher

International Journal of Clinical Case Reports and Reviews is a high quality journal that has a clear and concise submission process. The peer review process was comprehensive and constructive. Support from the editorial office was excellent, since the administrative staff were responsive. The journal provides a fast and timely publication timeline.

img

Joel Yat Seng Wong

Dear Cecilia Lilly, Editorial Coordinator, Endocrinology and Disorders, Thank you so much for your quick response regarding reviewing and all process till publishing our manuscript entitled: Prevalence of Pre-Diabetes and its Associated Risk Factors Among Nile College Students, Sudan. Best regards, Dr Mamoun Magzoub.

img

Dr Mamoun Magzoub

Dear Editorial Team, Clinical Cardiology and Cardiovascular Interventions. I am really grateful for the peers review; their feedback gave me the opportunity to reflect on the message and impact of my work and to ameliorate the article. The editors did a great job in addition by encouraging me to continue with the process of publishing.

img

Baciulescu Laura

Dear Mayra Duenas, Editorial Coordinator of ‘International Journal of Clinical Case Reports and Reviews Herewith I confirm an optimal peer review process and a great support of the editorial office of the present journal

img

Christoph Maurer

Dear Maria Emerson, Editorial Coordinator of ‘International Journal of Clinical Case Reports and Reviews’, I appreciate the opportunity to publish my article with your journal. The editorial office provided clear communication during the submission and review process, and I found the overall experience professional and constructive. Best regards, Elena Salvatore.

img

Dr Elena Salvatore

Dear Editorial Team, Journal-Clinical Cardiology and Cardiovascular Interventions, “Publishing my article with Clinical Cardiology and Cardiovascular Interventions has been a highly positive experience. The peer-review process was rigorous yet supportive, offering valuable feedback that strengthened my work. The editorial team demonstrated exceptional professionalism, prompt communication, and a genuine commitment to maintaining the highest scientific standards. I am very pleased with the publication quality and proud to be associated with such a reputable journal.” Warm regards, Dr. Mahmoud Kamal Moustafa Ahmed

img

Mahmoud Kamal Moustafa Ahmed

Dear Editorial Team, Clinical Cardiology and Cardiovascular Interventions. It was truly a rewarding experience to work with the journal “Clinical Cardiology and Cardiovascular Interventions”. The peer review process was insightful and encouraging, helping us refine our work to a higher standard. The editorial office offered exceptional support with prompt and thoughtful communication. I highly value the journal’s role in promoting scientific advancement and am honored to be part of it. Best regards, Meng-Jou Lee, MD, Department of Anesthesiology, National Taiwan University Hospital.

img

Dr Meng-JouLe

Dear Maria Emerson, Editorial Coordinator, Journal of Clinical Research and Reports. Thank you for publishing our case report: "Clinical Case of Effective Fetal Stem Cells Treatment in a Patient with Autism Spectrum Disorder" within the "Journal of Clinical Research and Reports" being submitted by the team of EmCell doctors from Kyiv, Ukraine. We much appreciate a professional and transparent peer-review process from Auctores. All research Doctors are so grateful to your Editorial Office and Auctores Publishing support! I amiably wish our article publication maintained a top quality of your International Scientific Journal. My best wishes for a prosperity of the Journal of Clinical Research and Reports. Hope our scientific relationship and cooperation will remain long lasting. Thank you very much indeed. Kind regards, Dr. Andriy Sinelnyk Cell Therapy Center EmCell

img

Dr Andriy Sinelnyk

I recommend without hesitation submitting relevant papers on medical decision making to the International Journal of Clinical Case Reports and Reviews. I am very grateful to the editorial staff. Maria Emerson was a pleasure to communicate with. The time from submission to publication was an extremely short 3 weeks. The editorial staff submitted the paper to three reviewers. Two of the reviewers commented positively on the value of publishing the paper. The editorial staff quickly recognized the third reviewer’s comments as an unjust attempt to reject the paper. I revised the paper as recommended by the first two reviewers.

img

Edouard Kujawski

Dear Chrystine Mejia, Editorial Coordinator, Journal of Neurodegeneration and Neurorehabilitation. “The peer review process was efficient and constructive, and the editorial office provided excellent communication and support throughout. The journal ensures scientific rigor and high editorial standards, while also offering a smooth and timely publication process. We sincerely appreciate the work of the editorial team in facilitating the dissemination of innovative approaches such as the Bonori Method.” Best regards, Dr. Matteo Bonori.

img

Dr Matteo Bonori

Dear Maria Emerson, Editorial Coordinator, we have deeply appreciated the professionalism demonstrated by the International Journal of Clinical Case Reports and Reviews. The reviewers have extensive knowledge of our field and have been very efficient and fast in supporting the process. I am really looking forward to further collaboration. Thanks. Best regards, Dr. Claudio Ligresti

img

Dr Claudio Ligresti

Dear Ms. Mayra Duenas, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews. “The International Journal of Clinical Case Reports and Reviews represented the “ideal house” to share with the research community a first experience with the use of the Simeox device for speech rehabilitation. High scientific reputation and attractive website communication were first determinants for the selection of this Journal, and the following submission process exceeded expectations: fast but highly professional peer review, great support by the editorial office, elegant graphic layout. Exactly what a dynamic research team - also composed by allied professionals - needs!" From, Chiara Beccaluva, PT - Italy.

img

Dr Chiara Giuseppina Beccaluva

Dear Clarissa Eric, Editorial Coordinator, Journal of Clinical Case Reports and Studies, Auctores Publishing LLC, USA Office: +1-(302)-520-2644. I would like to express my sincere appreciation for the efficient and professional handling of my case report by the ‘Journal of Clinical Case Reports and Studies’. The peer review process was not only fast but also highly constructive—the reviewers’ comments were clear, relevant, and greatly helped me improve the quality and clarity of my manuscript. I also received excellent support from the editorial office throughout the process. Communication was smooth and timely, and I felt well guided at every stage, from submission to publication. The overall quality and rigor of the journal are truly commendable. I am pleased to have published my work with Journal of Clinical Case Reports and Studies, and I look forward to future opportunities for collaboration. Sincerely, Aline Tollet, UCLouvain.

img

Dr Aline Tollet

Dear Chrystine Mejia, Editorial Coordinator, Journal of Neurodegeneration and Neurorehabilitation, Auctores Publishing LLC, We would like to thank the editorial team for the smooth and high-quality communication leading up to the publication of our article in the Journal of Neurodegeneration and Neurorehabilitation. The reviewers have extensive knowledge in the field, and their relevant questions helped to add value to our publication. Kind regards, Dr. Ravi Shrivastava.

img

Dr Ravi Shrivastava

Dear Clarissa Eric, Editorial Coordinator, Journal of Clinical Case Reports and Studies, I would like to express my deep admiration for the exceptional professionalism demonstrated by your journal. I am thoroughly impressed by the speed of the editorial process, the substantive and insightful reviews, and the meticulous preparation of the manuscript for publication. Additionally, I greatly appreciate the courteous and immediate responses from your editorial office to all my inquiries. Best Regards, Dariusz Ziora

img

Dariusz Ziora

Dear Ashley Rosa, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews, Auctores Publishing LLC. Thank you for publishing our article, Exploring Clozapine's Efficacy in Managing Aggression: A Multiple Single-Case Study in Forensic Psychiatry in the international journal of clinical case reports and reviews. We found the peer review process very professional and efficient. The comments were constructive, and the whole process was efficient. On behalf of the co-authors, I would like to thank you for publishing this article. With regards, Dr. Jelle R. Lettinga.

img

Dr Jelle Lettinga

Dear Jessica Magne, Editorial Coordinator, Clinical Cardiology and Cardiovascular Interventions, Auctores Publishing LLC. The peer review process of the journal of Clinical Cardiology and Cardiovascular Interventions was excellent and fast, as was the support of the editorial office and the quality of the journal. Kind regards Walter F. Riesen Prof. Dr. Dr. h.c. Walter F. Riesen.

img

Dr Walter F Riesen

Dear Erin Aust, Editorial Coordinator, Journal of General Medicine and Clinical Practice. We are pleased to share our experience with the “Journal of General Medicine and Clinical Practice”, following the successful publication of our article. The peer review process was thorough and constructive, helping to improve the clarity and quality of the manuscript. We are especially thankful to Ms. Erin Aust, the Editorial Coordinator, for her prompt communication and continuous support throughout the process. Her professionalism ensured a smooth and efficient publication experience. The journal upholds high editorial standards, and we highly recommend it to fellow researchers seeking a credible platform for their work. Best wishes By, Dr. Rakhi Mishra.

img

Dr Rakhi Mishra

Dr Hala Al Shaikh This is to acknowledge that the peer review process for the article ’ A Novel Gnrh1 Gene Mutation in Four Omani Male Siblings, Presentation and Management ’ sent to the International Journal of Clinical Case Reports and Reviews was quick and smooth. The editorial office was prompt with easy communication.

img

Hala Al Shaikh

Dear Agrippa Hilda, Editorial Coordinator, Journal of Neuroscience and Neurological Surgery. The entire process including article submission, review, revision, and publication was extremely easy. The journal editor was prompt and helpful, and the reviewers contributed to the quality of the paper. Thank you so much! Eric Nussbaum, MD

img

Dr Eric S Nussbaum

Dear Ashley Rosa, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews. Many thanks for publishing this manuscript after I lost confidence the editors were most helpful, more than other journals Best wishes from, Susan Anne Smith, PhD. Australian Breastfeeding Association.

img

Dr Susan Anne Smith

Dear Maria Emerson, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews, Auctores Publishing LLC. I am delighted to have published our manuscript, "Acute Colonic Pseudo-Obstruction (ACPO): A rare but serious complication following caesarean section." I want to thank the editorial team, especially Maria Emerson, for their prompt review of the manuscript, quick responses to queries, and overall support. Yours sincerely Dr. Victor Olagundoye.

img

Dr Victor Olagundoye

Dear Jessica Magne, Editorial Coordinator, Clinical Cardiology and Cardiovascular Interventions, Auctores Publishing LLC. I appreciate the journal (JCCI) editorial office support, the entire team leads were always ready to help, not only on technical front but also on thorough process. Also, I should thank dear reviewers’ attention to detail and creative approach to teach me and bring new insights by their comments. Surely, more discussions and introduction of other hemodynamic devices would provide better prevention and management of shock states. Your efforts and dedication in presenting educational materials in this journal are commendable. Best wishes from, Farahnaz Fallahian.

img

Dr Farahnaz Fallahian

Dear Ashley Rosa, Editorial Coordinator of the journal - Psychology and Mental Health Care. " The process of obtaining publication of my article in the Psychology and Mental Health Journal was positive in all areas. The peer review process resulted in a number of valuable comments, the editorial process was collaborative and timely, and the quality of this journal has been quickly noticed, resulting in alternative journals contacting me to publish with them." Warm regards, Susan Anne Smith, PhD. Australian Breastfeeding Association.

img

Dr Susan Anne Smith

Dear Jessica, and the super professional team of the ‘Clinical Cardiology and Cardiovascular Interventions’ I am sincerely grateful to the coordinated work of the journal team for the no problem with the submission of my manuscript: “Cardiometabolic Disorders in A Pregnant Woman with Severe Preeclampsia on the Background of Morbid Obesity (Case Report).” The review process by 5 experts was fast, and the comments were professional, which made it more specific and academic, and the process of publication and presentation of the article was excellent. I recommend that my colleagues publish articles in this journal, and I am interested in further scientific cooperation. Sincerely and best wishes, Dr. Oleg Golyanovskiy.

img

Dr Oleg Golyanovski

To Dear Erin Aust – Editorial Coordinator of Journal of General Medicine and Clinical Practice! I declare that I am absolutely satisfied with your work carried out with great competence in following the manuscript during the various stages from its receipt, during the revision process to the final acceptance for publication. Thank Prof. Elvira Farina

img

Dr Elvira Farina

My article, titled 'No Way Out of the Smartphone Epidemic Without Considering the Insights of Brain Research,' has been republished in the International Journal of Clinical Case Reports and Reviews. The review process was seamless and professional, with the editors being both friendly and supportive. I am deeply grateful for their efforts.

img

Gertraud Teuchert-Noodt

We found the peer review process quick and positive in its input. The support from the editorial officer has been very agile, always with the intention of improving the article and taking into account our subsequent corrections.

img

Dr David Vinyes

Dear Jessica Magne, with gratitude for the joint work. Fast process of receiving and processing the submitted scientific materials in “Clinical Cardiology and Cardiovascular Interventions”. High level of competence of the editors with clear and correct recommendations and ideas for enriching the article.

img

Dr Anyuta Ivanova

I thank the ‘Journal of Clinical Research and Reports’ for accepting this article for publication. This is a rigorously peer reviewed journal which is on all major global scientific data bases. I note the review process was prompt, thorough and professionally critical. It gave us an insight into a number of important scientific/statistical issues. The review prompted us to review the relevant literature again and look at the limitations of the study. The peer reviewers were open, clear in the instructions and the editorial team was very prompt in their communication. This journal certainly publishes quality research articles. I would recommend the journal for any future publications.

img

Dr Farooq Wandroo

"I am grateful for the opportunity of contributing to [International Journal of Clinical Case Reports and Reviews] and for the rigorous review process that enhances the quality of research published in your esteemed journal. I sincerely appreciate the time and effort of your team who have dedicatedly helped me in improvising changes and modifying my manuscript. The insightful comments and constructive feedback provided have been invaluable in refining and strengthening my work".

img

Dr Shweta Tiwari

To Dear Erin Aust, I would like to express my heartfelt appreciation for the opportunity to have my work published in this esteemed journal. The entire publication process was smooth and well-organized, and I am extremely satisfied with the final result. The Editorial Team demonstrated the utmost professionalism, providing prompt and insightful feedback throughout the review process. Their clear communication and constructive suggestions were invaluable in enhancing my manuscript, and their meticulous attention to detail and dedication to quality are truly commendable. Additionally, the support from the Editorial Office was exceptional. From the initial submission to the final publication, I was guided through every step of the process with great care and professionalism. The team's responsiveness and assistance made the entire experience both easy and stress-free. I am also deeply impressed by the quality and reputation of the journal. It is an honor to have my research featured in such a respected publication, and I am confident that it will make a meaningful contribution to the field.

img

Dr Tewodros Kassahun Tarekegn

I would like to express my sincere gratitude for the support and efficiency provided by the editorial office throughout the publication process of my article, “Delayed Vulvar Metastases from Rectal Carcinoma: A Case Report.” I greatly appreciate the assistance and guidance I received from your team, which made the entire process smooth and efficient. The peer review process was thorough and constructive, contributing to the overall quality of the final article. I am very grateful for the high level of professionalism and commitment shown by the editorial staff, and I look forward to maintaining a long-term collaboration with the International Journal of Clinical Case Reports and Reviews.

img

Cristina Berriozabal

Dear Agrippa Hilda- Editorial Coordinator of Journal of Neuroscience and Neurological Surgery, "The peer review process was very quick and of high quality, which can also be seen in the articles in the journal. The collaboration with the editorial office was very good."

img

Thomas Urban

I would like to offer my testimony in the support. I have received through the peer review process and support the editorial office where they are to support young authors like me, encourage them to publish their work in your esteemed journals, and globalize and share knowledge globally. I really appreciate your journal, peer review, and editorial office.

img

Zhao Jia

My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.

img

Luiz Sellmann

My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.

img

Sonila Qirko

My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.

img

Lin-Show Chin

Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner

img

Dr Susan Weiner

Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”

img

Zsuzsanna Bene

Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.

img

Dr Maria Regina Penchyna Nieto

Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.

img

Dr Maria Dolores Gomez Barriga

Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.

img

Maria Dolores Gomez Barriga

The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.

img

Lin Shaw Chin

Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.

img

Gomez Barriga Maria Dolores

Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.

img

Khurram Arshad

Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.

img

Rui Tao

“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.

img

George Varvatsoulias

Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.

img

Tania Munoz

I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.

img

S Munshi

I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.

img

Husain Taha Radhi

I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.

img

Dr Tong Ming Liu

We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.

img

Dr Griffith

I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.

img

Douglas Miyazaki

"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".

img

Jesus Simal-Gandara

I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!

img

Baheci Selen

Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.

img

Bruno Chauffert

Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.

img

Dr Suramya Dhamija

International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.

img

Andreas Filippaios

Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.

img

Raed Mualem

As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.

img

Dr Shiming Tang

Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.

img

Hao Jiang

This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.

img

Prof Sherif W Mansour

Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.

img

Bernard Terkimbi Utoo

Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.

img

Pedro Marques Gomes

Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.

img

Anthony Kodzo-Grey Venyo

Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.

img

Katarzyna Byczkowska

Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.

img

Orlando Villarreal

The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.

img

Sing-yung Wu

We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.

img

Layla Shojaie

Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.

img

Mina Sherif Soliman Georgy

Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.

img

Ziemlé Clément Méda

Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.

img

Delcio G Silva Junior

Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.

img

Virginia E. Koenig