Study on the Anti-Aging Effect of Polygonatum Cyrtonema Hua on Human Skin Fibroblasts

Research Article | DOI: https://doi.org/10.31579/2690-4861/586

Study on the Anti-Aging Effect of Polygonatum Cyrtonema Hua on Human Skin Fibroblasts

  • Yan Xinyu
  • Sun Yi
  • Chen Mo *
  • Zhu Le
  • Zhao Ya *

Shanghai Jahwa United Co., Ltd., Shanghai, 200082, China.

*Corresponding Author: Chen Mo and Zhao Ya, Shanghai Jahwa United Co., Ltd., Shanghai, 200082, China.

Citation: Yan Xinyu, Sun Yi, Chen Mo, Zhu Le, Zhao Ya, (2024), Study on the anti-aging effect of Polygonatum cyrtonema Hua on human skin fibroblasts, International Journal of Clinical Case Reports and Reviews, 19(5); DOI:10.31579/2690-4861/586

Copyright: © 2024, Chen Mo and Zhao Ya. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Received: 21 October 2024 | Accepted: 12 November 2024 | Published: 20 November 2024

Keywords: polygonatum cyrtonema hua; human skin fibroblasts; anti-aging; SASPs

Abstract

Background: Polygonatum cyrtonema Hua (PCH) is a traditional Chinese medicine, a plant with the same origin of medicine and food, and has high edible value. However, whether Polygonatum cyrtonema Hua has skin care efficacy remains to be studied.

Aims: To explore the anti-aging effect of Polygonatum cyrtonema Hua extract on human skin fibroblasts (FB).

Materials and Methods: An aging model of FB cells induced by H2O2 plus passage was established in vitro. The effect of PCH extract on β - galactosidase, a key index of cell aging, was detected by staining method; The quantitative real-time polymerase chain reaction (qRT-PCR) was used to detect the mRNA expression level of p21 in cells treated with PCH extract; ELISA was used to detect the effects of IL-6, IL-8 inflammatory factors, matrix metalloproteinase-1 (MMP-1) and MCP chemokines in senescent cells; Immunofluorescence detection of DNA damage related protein γH2A.X in cells treated with PCH extract.

Results: Compared with the blank control group, PCH extract can reduce the activity of β - galactosidase in FB cells, reduce the mRNA expression level of p21, inhibit the content of IL-6, IL-8, MMP1, MCP, and inhibit the expression of γH2A.X.

Conclusions :PCH extract can fight against cell aging by reducing SASPs related indicators after cell aging, and can be used as a potential natural active substance for skin anti (inflammatory) aging.

Introduction

Anti-aging has been an eternal topic since ancient times. People have been trying to find effective and safe anti-aging ingredients. Therefore, we prefer to add pure natural anti-aging ingredients to anti-aging skin care products to achieve anti-aging effects [1]. China is rich in herbal resources, and good natural anti-aging actives may be found.

Polygonatum belongs to the genus Polygonatum in the Liliaceae family. It belongs to the homology of medicine and food [2]. The ancients used Polygonatum as a food for health preservation. The rhizomes are thick and rich in nutrients, including starch, polysaccharides, proteins, etc., as well as rich in essential amino acids and vitamins for the human body. At the same time, the history of medicinal use of Polygonatum has a long history in the records of Chinese herbal medicine. The "Shenxian Zhicao Jing [3]" records: " Polygonatum can widen the middle and replenish qi, harmonize the five internal organs, strengthen the muscles, strengthen the bone marrow, double the strength, make the body not grow old for many years, the color is bright, the whitening becomes darker, and the teeth are regenerated." All of these show that Polygonatum has anti-aging health benefits.

There are three sources of Polygonatum recorded in the 2015 edition of the Chinese Pharmacopoeia, namely Polygonatum sibiricum Red., Polygonatum kingianum Coll. et Hemsl., and Polygonatum cyrtonema Hua (PCH). Compared with the first two types, there are fewer studies on PCH. PCH is mainly distributed in the southern provinces of China, and its rhizomes also have medicinal and edible values [4]. It is reported that PCH has anti-fatigue [5], antioxidant [6], anti-tumor [7] and other effects. There are reports in the literature that the polysaccharide, the main active ingredient of PCH, can extend the lifespan of Caenorhabditis elegans. However, these anti-aging studies on Polygonatum sibiricum mainly focus on oral administration, and there is relatively little research on its external skin effects. Although researchers have previously explored its anti-aging effects on mouse skin [8], it remains to be seen whether it has the same effect on human skin cells. 

In this study, we have chosen Polygonatum cyrtonema Hua (PCH), a lesser-studied species, as our research subject, with the intention of developing a natural anti-aging ingredient that can be applied in skincare products. 

It is known that the accumulation of senescent cells can cause the aging of tissues or organs. Studies have shown that the number of senescent fibroblasts increases with age, triggering skin aging and accompanied by changes in some aging markers [9]. It is reported that there are many aging-related indicators in skin aging, such as increased SA-β-gal activity [10]; changes in the expression of cyclin-dependent kinase inhibitors (CDKIs) (such as p21, etc.) [11]; elevated expression of senescence-associated secretory phenotype (SASP) and increased DNA damage, etc [12]. This article established a human skin fibroblast aging model using H2O2, and evaluated the anti-bacterial activity of PCH extract through SA-β-gal staining, expression of p21, aging-related secretory phenotype SASPs and expression of DNA damage marker γH2A.X. 

Materials and Methods

1. Materials

Polygonatum cyrtonema Hua (produced in Enshi, Hubei), human fibroblasts (Shaanxi Biocell General Testing Technology Co., Ltd.,Fb19052002), low-sugar DMEM culture medium (Gibco, 11885084), PBS (Gibco, 14040117), H2O2 (Sigma, 386790-M), IL-6 ELISA kit (Abcam, ab178013), IL -8 ELISA Kit (Abcam, ab214030), MCP-1 ELISA Kit (Proteintech, KE00091), Collagen Ι ELISA Kit (Abcam, ab285250), MMP-1 ELISA Kit (Abcam, ab215083), TGF-β1 (Peprotech, 100-21-10UG), dexamethasone (DXMS) (Sigma, D1756), RNAiso Plus (Takara, 9108), reverse transcription kit (Takara, RR037), TB Green Premix Ex Taq (Takara, RR42WR), γH2A.X antibody (Abcam,ab81299), cell senescence β-galactosidase staining kit (Beyotime,C0602), Hochest 33342(Sigma, B2261)

2.Preparation of rhizome extract of PCH [13]

Take appropriate amount of rhizome of PCH and soak it in deionized water at 90℃~100℃ for 1 hour. After that, filter and concentrate to 1 times the volume of the original herb. Add ethanol to a final concentration of 70%. After thorough stirring, the mixture was left to stand overnight at room temperature. The next day the extract was again filtered and concentrated to one times the volume of the original herb. The extract was thus obtained.

3.Establishment of H2O2-induced fibroblast senescence model [14]

D0: Inoculate fibroblasts with cell batch number Fb19052002 into a 6-well plate at a seeding density of 1×105/well; D1: Add serum-free medium containing 400 μM H2O2 and stimulate for 2 hours; discard the solution and wash three times with PBS; add Incubate for 24 hours in the normal culture medium of the sample working solution; D2: discard the liquid and wash three times with PBS; add serum-free medium containing 400 μM H2O2 and stimulate for 2 hours; discard the liquid and wash three times with PBS; after adding the normal culture medium containing the sample working solution Incubate for 24 hours; D3: Repeat the work of D2; D4: Digest with 0.25% trypsin-EDTA for 3 minutes, add the normal medium of the sample working solution for subculture. After 5 generations of continuous passage, cells are seeded into a 6-well plate or a 24-well plate at a plating rate of 80% to 90%, and samples are collected the next day.

4.ELISA test [15]

1) Inoculation: Inoculate cells into a 6-well plate at a plating rate of 80% to 90%, and incubate in an incubator (37°C, 5% CO2) for 24 hours. 2) ELISA detection: After incubation for 24 hours, collect the supernatant and perform detection according to the instructions of the ELISA kit.

5.SA-β-gal staining

Cell senescence β-galactosidase staining kit (Beyotime,C0602) was used according the vendor's protocol.

6.Real-time fluorescence quantitative polymerization chain reaction (q-RT-PCR) [16]

1) Inoculation: Inoculate cells into a 6-well plate at a plating rate of 80% to 90%, and incubate in an incubator (37°C, 5% CO2) for 24 hours. 2) Sample collection: After incubation for 24 hours, discard the supernatant, wash twice with 1 mL/well PBS, add 1 mL RNAiso Plus to each well, pipette to lyse the cells, and collect the sample. 3) Detection: RNA is extracted, reverse transcribed into cDNA, and fluorescent quantitative PCR detection is performed. The 2-△△CT method is used to calculate the results. q-RT-PCR primer information: p21-F: TCTCTGTGTTAGGGGTATATGATGG; p21-R: GAAGGTCGCTGGACGATTTG

7. Immunofluorescence tests [17]

1) Inoculation: Inoculate cells into a 24-well plate at a plating rate of 80% to 90%, and incubate in an incubator (37°C, 5% CO2) for 24 hours. 2) Sample collection: After incubation for 24 hours, discard the solution, wash three times with 1 mL/well PBS, add 1 mL 4% paraformaldehyde to each well and fix at room temperature for 15 min. 4) Blocking: Add 200 μL goat serum dropwise per well and block at room temperature for 60 minutes. 5) Incubate the primary antibody: Discard the goat serum blocking solution, add an appropriate proportion of diluted primary antibody (200 μL/well) (goat serum dilution), and incubate overnight at 4°C. 6) Incubate the secondary antibody: wash with PBS 3 times/5 min, drop into the appropriate diluted fluorescent secondary antibody (200 μL/well), and incubate for 1 h at room temperature in the dark. 7) Nuclear staining: wash with PBS 3 times/5 min, add Hochest 33342 (200 μL/well) dropwise, and incubate at room temperature for 5 min. 8) Cover the slide: Use a needle to pick out the slide, add a drop of anti-fade agent on the slide and place the slide on the slide. 9) Observe and take pictures: Take pictures under a fluorescence microscope within 24 hours.

8. Statistical analysis

All experimental data are expressed as mean ± standard error (± SEM), and all P values are tested by unpaired two-tailed Student t.test in excel. The LSD test was used for comparison between groups; P≤0.05 (two-sided) for various tests indicates significant differences and statistical significance.

Results

1.Effect of PCH extract on aging markers SA-β-gal and p21

Previous research has shown that H2O2 can cause the aging of fibroblasts [18]. In order to explore whether PCH extract has anti-aging effects, we conducted SA-β-gal staining experiments [10]. The results showed that compared with untreated fibroblasts (BC group), H2O2-treated cells (NC group) The proportion of SA-β-gal positive cells increased significantly. Compared with the NC group, the proportion of SA-β-gal positive cells was significantly reduced after incubation with PCH extract at 0.1 % concentration and 1 % concentration, which were reduced by 95.6 % and 97.7 % respectively, even lower than that in the BC group (Figure 1 and Table 1). At the same time, we performed qRT-PCR detection of the aging marker p21 and found that the expression of p21 was reduced by 87.5 % and 90.7 % after incubation with PCH extract at 0.1 % concentration and 1 % concentration (Figure 2). The above results show that PCH extract has anti-aging effects.

Figure 1: SA-β-gal staining of H2O2-induced fibroblasts.

a. White-field images of SA-β-gal staining. BC: blank control group treated with DMEM; NC: negative control group treated with 400uM H2O2; PC-TGF-β1: positive control group treated with 400uM H2O2 and 100 ng/mL TGF-β1; PCH: Polygonatum cyrtonema Hua. Scale bar: 50 μm. Arrow: SA-β-gal positive cells. b. Quantification for the a figure experiments. n=3 each. P values are based on two-tail t-test, and all error bars indicate standard errors. Compared with BC, p < 0> % concentration compares with PCH extract at 1 % concentration, p < 0>

SampleMeanSD
BC5.30 %0.82 %
NC80.31 %3.03 %
PC-TGF-β10.96 %0.03 %
PCH-0.1 %3.50 %0.19 %
PCH-1 %1.85 %0.25 %

Table 1: The proportion of SA-β-gal positive cells.

Figure 2: p21 mRNA expression of H2O2-induced fibroblasts. n=3 each.

2.Effect of PCH extract on the expression of SASP factors

SASP (senescence-associated secretory phenotype) is a typical feature of cellular senescence. IL-6 and IL-8 are one of the main cytokines in SASP signaling and play a direct mediating role in inflammation [19, 20]. MCP-1 is a member of the chemokine CC subfamily, which mediates inflammatory responses and can also induce the production of inflammatory mediators [21]. MMP-1 is a protease that promotes cell invasion and metastasis [22]. At the same time, MMP-1 is involved in the degradation process of collagen [23]. We used ELISA to detect IL-6, IL-8, and MCP-1 and MMP-1. The results showed that 0.1 % concentration of PCH extract can significantly inhibit the increase of IL-6, IL-8, MCP-1 and MMP-1 caused by H2O2. The inhibition rates are 12.13 %, 11.43 %, 80.45 %, and 8.18 % respectively; the PCH extract at a concentration of 1 % can also significantly inhibit the increase in IL-6, IL-8, MCP-1 and MMP-1 caused by H2O2. The inhibition rates are 34.2 %, 29.43 %, 83.54 %, and 38.06 % respectively (Figure 3), indicating that PCH extract can inhibit the expression of SASP-related factors.

Figure 3a-d: The effect of PCH extract on content of IL-6 IL-8 MCP-1 and MMP-1 in H2O2-induced fibroblasts was determined by ELISA. n=3 each.

3.Effect of PCH extract on DNA damage repair

DNA damage is also one of the signs of cellular aging. As age increases, DNA damage continues to increase, and γH2A.X is a sensitive molecular 

marker of DNA damage and repair, used to monitor the occurrence and regression of DNA damage [24]. We performed immunofluorescence staining of γH2A.X on fibroblasts and found that compared with the BC group, PCH extract can significantly reduce the expression of γH2A.X.
 

Figure 4: Effect of PCH extract on γH2A.X protein expression in H2O2-induced fibroblasts. (a): Immunofluorescence staining results of γH2A.X in each group, Scale bar: 50 μm; (b): Relative IOD average of γH2A.X in each group.   n=3 each.

Discussion

The skin is the largest organ of the body and plays an important protective role. Senescent cells have been found to accumulate with age and may contribute to age-related skin changes. Like other tissues, skin aging is affected not only by external factors caused by the environment, but also by endogenous changes. Studies have shown that the activity of catalase in aging skin is significantly reduced, and the content of H2O2 is significantly increased [25]. H2O2 will cause an increase in the content of reactive oxygen species ROS in the skin, and ROS is one of the main contributors to aging [26]. On the one hand, excess ROS will activate the NF-κB pathway, thereby activating SASP factors, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6 and other molecules expression, thereby inducing an inflammatory response [27]; on the other hand, ROS can cause DNA damage [28] and induce aging. Therefore, H2O2 was used as an inducer of skin fibroblasts in this study to simulate the aging phenomenon caused by the oxidative process during skin aging in vivo [18].

SA-β-gal [10] and p21[11] are the classical markers of cell senescence. In this study, we found that PCH extract was effective in reducing the expression of SA-β-gal and p21 in H2O2-induced human skin fibroblasts, suggesting the potential of PCH extract in anti-aging of human skin cells. Meanwhile, PCH extract can reduce the expression of inflammation-related factors such as IL-6, IL-8, MCP-1 and MMP-1[19-22] in fibroblasts. It also suggests a potential role of PCH extract in anti-inflammatory aging, which needs to be followed up with further 

demonstration. In addition, DNA damage is one of the important factors in skin aging, and in this study, we also found that PCH extract had a significant reduction of the DNA damage marker γH2A.X protein [24], and had a better effect as the concentration increased. Perhaps in the future, the active ingredients can be further enriched through the improvement of the extraction process, in order to enhance the efficacy of PCH extracts in skin anti-aging.

Although some interesting findings were obtained in this study, there are still some limitations. For example, the mechanism of action of PCH extract was not thoroughly investigated in this study, and further studies are needed to elucidate the specific biological effects and molecular mechanisms. Meanwhile, the anti-aging gene Sirtuin 1[29] is critical to the aging process of the skin and the prevention of various chronic diseases. Whether PCH is a Sirtuin 1 activator and prevents the actions of Sirtuin 1 inhibitors with relevance to skin aging is a question worthy of further exploration.

In summary, we found the anti-aging effect of PCH extract on human skin fibroblasts, which is expected to be used as a natural, safe and effective anti-aging ingredient in skin care products in the future.

Conclusions

This study has found that the extract of Polygonatum cyrtonema Hua has anti-aging effects on human skin fibroblasts and can be added to skincare products as a natural anti-aging active ingredient.

References

Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.

img

Virginia E. Koenig

Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.

img

Delcio G Silva Junior

Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.

img

Ziemlé Clément Méda

Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.

img

Mina Sherif Soliman Georgy

We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.

img

Layla Shojaie

The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.

img

Sing-yung Wu

Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.

img

Orlando Villarreal

Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.

img

Katarzyna Byczkowska

Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.

img

Anthony Kodzo-Grey Venyo

Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.

img

Pedro Marques Gomes

Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.

img

Bernard Terkimbi Utoo

This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.

img

Prof Sherif W Mansour

Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.

img

Hao Jiang

As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.

img

Dr Shiming Tang

Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.

img

Raed Mualem

International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.

img

Andreas Filippaios

Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.

img

Dr Suramya Dhamija

Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.

img

Bruno Chauffert

I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!

img

Baheci Selen

"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".

img

Jesus Simal-Gandara

I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.

img

Douglas Miyazaki

We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.

img

Dr Griffith

I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.

img

Dr Tong Ming Liu

I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.

img

Husain Taha Radhi

I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.

img

S Munshi

Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.

img

Tania Munoz

“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.

img

George Varvatsoulias

Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.

img

Rui Tao

Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.

img

Khurram Arshad

Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.

img

Gomez Barriga Maria Dolores

The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.

img

Lin Shaw Chin

Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.

img

Maria Dolores Gomez Barriga

Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.

img

Dr Maria Dolores Gomez Barriga

Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.

img

Dr Maria Regina Penchyna Nieto

Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, The review process for the article “The Handling of Anti-aggregants and Anticoagulants in the Oncologic Heart Patient Submitted to Surgery” was extremely rigorous and detailed. From the initial submission to the final acceptance, the editorial team at the “Journal of Clinical Cardiology and Cardiovascular Interventions” demonstrated a high level of professionalism and dedication. The reviewers provided constructive and detailed feedback, which was essential for improving the quality of our work. Communication was always clear and efficient, ensuring that all our questions were promptly addressed. The quality of the “Journal of Clinical Cardiology and Cardiovascular Interventions” is undeniable. It is a peer-reviewed, open-access publication dedicated exclusively to disseminating high-quality research in the field of clinical cardiology and cardiovascular interventions. The journal's impact factor is currently under evaluation, and it is indexed in reputable databases, which further reinforces its credibility and relevance in the scientific field. I highly recommend this journal to researchers looking for a reputable platform to publish their studies.

img

Dr Marcelo Flavio Gomes Jardim Filho

Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”

img

Zsuzsanna Bene

Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner

img

Dr Susan Weiner

My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.

img

Lin-Show Chin

My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.

img

Sonila Qirko

My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.

img

Luiz Sellmann