AUCTORES
Chat with usResearch Article | DOI: https://doi.org/10.31579/2641-0419/018
1 División de Cardiología. HospitalGeneral deAgudos J.M. Ramos Mejía. Ciudad Autónomade Buenos Aires.
2 Servicio de Diabetes y Nutrición. HospitalGeneral de AgudosJ.M. Ramos Mejía.Ciudad Autónoma de Buenos Aires.
3 Academia Nacionalde Medicina . Argentina.
4 Instituto de Investigaciones Cardiológicas Prof. Dr. AlbertoTaquini. Facultad de Medicina. Universidad de Buenos Aires.
*Corresponding Author: Carbajales J, División de Cardiología. Hospital General de Agudos J.M. Ramos Mejía. Ciudad Autónoma de Buenos Aires.
Citation: Carbajales J, Principato MB , Duarte A , Tomatti AL, Paolucci AG. Title: Relationship between the Aingle Nucleotide Polymorphism rs4704963 (t> c) of the early b-cell Factor 1 gene and Smoking in a Population with Risk Factors for Coronary Heart Disease with and without Acute Coronary Syndromes Treated in Buenos aires city, Argentina. J.Clinical Cardiology and Cardiovascular Interventions,2(1);Doi:10.31579/2641-0419/018
Copyright: © Carbajales J. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Received: 05 September 2019 | Accepted: 17 September 2019 | Published: 04 October 2019
Keywords: acute coronary syndromes ; coronary heart disease; nucleotide polymorphism
Introduction: Early B-cell factor 1 (EBF1) gene participates in the development of the central nervous system and is expressed in adipocytes and olfactory neuroepithelium, which is intimately linked with the emotion and reward system in adults. For this reason, it could be linked to tobacco addiction
Objective: The aim of this study was to determine probable association between the EBF1 gene rs4704963 SNP (T>C) with smoking habits in a population of patients with multiple coronary risk factors (CRF) with and without acute coronary syndromes (ACS).
Materials and methods: Between December 2015 and March 2017, 104 consecutive patients with two or more risk factors, with or without ACS were included. A 10-mL blood sample was collected from all the patients for SNP determination. DNA genotyping was carried out using the nested PCR technique and subsequent sequencing.
Results: Mean age was 59.1 ± 9.17 years and 59.6% were men. The most common CRF were smoking habits (60.6%) hypertension (56.7%) and diabetes (48.1%).None of the patients had the homozygous T / T haplotype while 17 patients (16.3%) presented the T / C haplotype for heterozygous SNP. Among the 17 patients with the SNP detected, 16 (94.1%) were smokers compared to 54% of smokers in those patients without the SNP detected (p = 0.002).
In those patients with ACS and smoking habits, the SNP was detected in 21.3% versus 0% in those with ACS and no history of smoking habits (p= 0.029)
Conclusion: A significant association was observed between the EBF1 gene rs4704963 SNP (T> C) with smoking habits in patients with ACS and in those with CRF without ACS. Further research including more patients is necessary to confirm these findings in order to customize decision-making to prevent this addiction and indicate the appropriate treatment when smoking is present.
Tobacco is one of the greatest threats to public health the world has to cope with, with more than seven million deaths per year, including six million deaths due to direct tobacco use and around 890,000 attributable to environmental tobacco smoke.
In 2000, 27% of the world population smoked compared to 20% in 2016 [1]. In Argentina, 40,000 people die per year as a result of tobacco use and 6000 due to passive smoking [2].
In terms of public health policies, it would be important to identify those persons genetically predisposed to develop addiction in order to design preventive actions and gene therapies.
The contribution of genetic determinants in nicotine addiction has been a subject of research for many years, with evidence about the determining role of some genes in such addiction.
In 1958, Fisher described the possible association between genome, tobacco use and lung cancer; later, he conducted a study on monozygotic and dizygotic German male twins and reported that the concordance of smokers was greater among monozygotic twins than among dizygotes [3].
The study of nicotinic receptors has become increasingly important; the most conclusive findings were related to cholinergic nicotinic receptor subunit (CHRNA)3, CHRNA4 and CHRNA5 genes and to the associations between the CHRNB3-CHRNA6 genes and CHRNA5 ‑CHRNA3 ‑ CHRNB4 genes [4].
In 2008, Ovide F. Pomerleau et al. reported that polymorphism in the CHRNA5 sub-unit was significantly associated with better pleasurable responses to initial cigarettes in regular smokers, in an a priori test. These findings suggest that subjective experiences about experimentation with smoking may mediate the development of nicotine dependence [5].
Thanks to genomics, we now know that the susceptibility of patients to polygenic diseases, as most cardiovascular diseases, may be due to the fact that the genes involved have single nucleotide changes along their structure called SNP (single nucleotide polymorphism) with a frequency in the population greater than 5%. Therefore, the importance of detecting such SNPs is significant [6].
This association of polymorphisms has also been observed with addictions, as in the case of SNP in the catechol-O-methyltransferase (COMT) and CHRNA5 genes that is associated with tobacco addiction [7,8,9].
Although the early B-cell factor 1 (EBF1) gene participates in the development of the central nervous system and is expressed in adipocytes and in olfactory neuroepithelium (intimately linked with the emotion and reward system) in adults [10], its possible relationship with tobacco addiction had not been previously explored.
The aim of our study was to investigate the probable association between the EBF1 gene rs4704963 SNP (T>C), the most common EBF1 gene SNP, with smoking, in a population of patients with multiple coronary risk factors (CFR) with and without acute coronary syndrome (ACS).
We conducted an observational and prospective study to determine the prevalence of polymorphism in a population of smokers, with or without ACS. The study population was made up of 104 patients who were treated in the Department of Cardiology at the Ramos Mejía Hospital in the city of Buenos Aires, Argentina. Patients who presented ≥ two CRF with or without ACS were consecutively included between December 2015 and March 2017.
All the patients included were men and women > 18 years and were categorized as follows:
Smokers: current smokers or former smokers who had quit smoking one year before or greater.
Non-smokers: patients who had never smoked.
Patients who refused to sign the informed consent form and those with a history of severe known conditions (excluding cardiovascular diseases), or with life expectancy < one> than 2 mg /dL).
All the patients signed an informed consent form. The protocol was approved by the institutional Committee on Ethics.
A10-mL blood sample was collected from all the patients for SNP determination. For the genetic analysis, DNA was isolated using a commercially available Wizard® Genomic DNA Purification Kit from Promega.DNA concentration was estimated by measuring the absorbance in nanodrop (De novix) at 260nm.This DNA was used to amplify the segment of interest by means of a nested polymerase chain reaction (PCR) in order to increase specificity and reduce sequencing costs.
The following primers (Genbiotech) were used for the first PCR reaction: First forward: 5`AGGAGAACATGCTTTGCCGT3`; First reverse: 5`AGACACTTCAGGCTGACACA3` and the PCR reaction was carried out under the following conditions: 1- initial denaturation at 94 ° C for 2min, 2- denaturation at 92 ° C for 15 sec, 3- pairing at 55 ° C for 15 s, 4 - extension at 68 ° C for 70 s, 5- final extension at 68 ° C for 5 min. Items 2, 3 and 4 were repeated 35 times (35 cycles).
The following primers (Genbiotech) were used for the second PCR reaction: First forward: 5`GCCAGGATTCACTATCTTTGGAC3`; First reverse: 5`ACAGCTCTAAGCTTCCTCCC3` and the PCR reaction was carried out under the following conditions: 1- initial denaturation at 94 ° C for 2min, 2- denaturation at 92 ° C for 15 s, 3- pairing at 53 ° C for 15 s , -4- extension at 68 ° C for 30 s, -5- final extension at 68 ° C for 5 min. Items 2, 3 and 4 were repeated 35 times.
Amplicon was sequenced on the Macrogen platform. With the results obtained, the presence of the polymorphism of interest was evaluated using the DNA Baser software.
All the calculations were performed with the SPSS software package, version 22.0 (SPSS Inc., Chicago, IL, USA).
Continuous variables were expressed as mean ± standard deviation, while categorical variables were expressed as absolute and relative frequencies.
The chi square test was used to evaluate the association between polymorphism and the presence of ACS. The relative risk (OR) was calculated with a 95% confidence interval (CI). A p value ≤ 0.05 was considered statistically significant.
Mean age was 59.1 ± 9.17 years and 59.6% were men. Acute coronary syndrome was identified in 65.4% of the patients whose mean age was 59 ± 8.83 years and 75% were men; 34.6% presented CRF without ACS with a mean age of 59.5 ± 9.88 years and 30.6% of these patients were men.
Of the 104 patients, the prevalence rates of CRF were estimated to be48.1% for diabetes (DBT), 56.7% for hypertension (HT), 45.2% for dyslipidemia (DLP), 38.5% for obesity and 60.6% for smoking habits (Table 1).Age (mean ± SD)
None of the patients had the homozygous T / T haplotype while 17 patients (16.3%) presented the T / C haplotype for heterozygous SNP (Figure 1).
Among the 17 patients with the SNP detected, 16 (94.1%) were smokers compared to 54% of smokers in those patients without SNP detected (p = 0.002) (Figure 2).
In those patients with ACS and smoking habits, the SNP was detected in 21.3% versus 0% in those with ACS and no history of smoking habits (p= 0.029)
In this study, we tried to determine the prevalence of EBF1 gene rs4704963 SNP (T>C) in smokers and non-smokers and its association with the presence of ACS, considering a dominant genetic model.
EBF1 is a member of the EBF family of genes, which is widely expressed in many tissues such as B lymphocytes, bone marrow, olfactory neurons and adipocytes [11]. This gene plays an important role in promoting adipogenesis [12]. It has been shown that leptin concentrations were significantly decreased in knockout mice for EBF1 [13]. Leptin produced in adipocytes is an essential hormone for the prevention of obesity, since it regulates energy expenditure, appetite and metabolism, and leptin deficits result in the development of obesity.
Shah et al. studied families with high LDL-cholesterol levels and found an association with changes in the long arm of chromosome 5 (5q.) which is the genomic location of the EBF1 gene [14].
Subsequently, Nolan et al. showed that variations in genes located on a portion of chromosome 5 (5q31-33), as the EBF 1 gene, were related to early onset of cardiovascular disease [15]. Moreover, the rs4704963 SNP (T>C), evaluated in our study is one of the polymorphisms associated with atherosclerosis and cardiovascular disease [16].
This study explored the possible relationship between EBF1 gene polymorphism and tobacco addiction. As EBF1 gene is expressed in the olfactory neuroepithelium and it has been hypothesized that olfactory neuroepithelium abnormalities may generate susceptibility to tobacco addiction.
Our results show a high prevalence of the SNP analyzed in the total population :17 patients (16.5%) presented T / C haplotype for heterozygous SNPA more significant finding was that among the 17 patients who had the SNP, the prevalence of smokers was significantly higher (n = 16, 94.1%) versus those without the SNP (54%; p= 0.002).
Also the SNP was detected in 21.3% of the patients with ACS and smoking habits, versus 0% in those with ACS and no history of smoking habits (p= 0.029)
These findings would be consistent with Fisher's initial statement [3] about the possibility that the same genes would determine susceptibility to tobacco use and to the development of tobacco-related diseases.
Further research including more patients is necessary to confirm these findings, in order to make a thorough analysis of the characteristics of the smoking habits of those affected by this addiction. This will allow us investigate the possible relationship between these polymorphisms and the intensity of tobacco use, nicotinic dependence and the result of smoking cessation treatments.
The results of this study are the first reported about the association between the EBF1 gene rs4704963 SNP (T> C) with smoking habits, in patients with CRF with or without ACS. These encouraging results need to be confirmed with greater number of patients in order to demonstrate the effectiveness of genetic tests to customize decision-making to prevent this addiction and indicate the appropriate treatment when smoking is present.
The research was conducted following the Resolution 1490/07 of the Ministry of
Health that approved the “Guidelines for Good Clinical Practice in Research on Human Subjects”, and the internationally recognized Good Clinical Research Practice (GCP-ICH), the recommendations of the declarations of Nuremberg, Helsinki with the corresponding amendments (Washington 2002, Tokyo 2004, Seoul 2008 and Fortaleza 2013) and the Law 3301 of the Government of the City of Buenos Aires regarding the “Protection of Rights of Subjects in Research ".
The study was approved by the Committee on Ethics of the Ramos Mejía Hospital.
Patients were asked to sign an informed consent form and received the original document.
The patients were identified by their initials, by a number and by the group to which they belonged, and the real identity was only known by the investigator to protect the confidentiality of all the information according to the Argentine personal data protection law 25,326.
Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.
Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.
Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.
Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.
We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.
The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.
Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.
Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.
Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.
Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.
Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.
This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.
Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.
As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.
Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.
International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.
Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.
Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.
I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!
"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".
I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.
We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.
I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.
I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.
I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.
Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.
“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.
Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.
Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.
Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.
The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.
Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.
Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, The review process for the article “The Handling of Anti-aggregants and Anticoagulants in the Oncologic Heart Patient Submitted to Surgery” was extremely rigorous and detailed. From the initial submission to the final acceptance, the editorial team at the “Journal of Clinical Cardiology and Cardiovascular Interventions” demonstrated a high level of professionalism and dedication. The reviewers provided constructive and detailed feedback, which was essential for improving the quality of our work. Communication was always clear and efficient, ensuring that all our questions were promptly addressed. The quality of the “Journal of Clinical Cardiology and Cardiovascular Interventions” is undeniable. It is a peer-reviewed, open-access publication dedicated exclusively to disseminating high-quality research in the field of clinical cardiology and cardiovascular interventions. The journal's impact factor is currently under evaluation, and it is indexed in reputable databases, which further reinforces its credibility and relevance in the scientific field. I highly recommend this journal to researchers looking for a reputable platform to publish their studies.
Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”
Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner