Research Article | DOI: https://doi.org/10.31579/2692-9759/100
October 6 University, 6th of October City, Egypt.
*Corresponding Author: Jilan A. Nazeam, October 6 University, 6th of October City, Egypt.
Citation: Sylvia A. Boshra, Jilan A. Nazeam, (2023), Linum Usitatissimum oil Fraction Reverse Cardiac Remodeling at Molecular level: Suppressing miRNA-29b and miRNA 1 genes in Isoproterenol In vivo Model, Cardiology Research and Reports. 5(3); DOI:10.31579/2692-9759/100
Copyright: © 2023, Jilan A. Nazeam. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Received: 12 June 2023 | Accepted: 23 June 2023 | Published: 30 June 2023
Keywords: flaxseed oil; miRNA-1; ISO; CVD; MMP9; CTNI
Linum usitatissimum (flaxseed) produce one of the oldest commercial oils which use traditionally as a functional food for lowering cholesterol level. Nevertheless, to date, there is no scientific evidence to assess the role of flaxseed oil in cardiac remodeling management. The study aimed to clarifying the underlying mechanism of standardized oil to restore cardiac remodeling in a heart toxicity rat model induced by isoproterenol (ISO). Oil fraction was purified, and major components were identified by gas-chromatography-mass spectrometry (GC-MS). The in vivo tests were conducted by ISO (85 mg/kg/ twice subcutaneously) with 24 hours between each dose. The rats were treated with flaxseed oil fraction (100 mg/kg orally) and the same dose was used for omega 3 as a positive control group. GC- MS revealed that α-linolenic acid (24.6%), oleic acid (10.5%), 6-octadecenoic acid (Z), 2,3 dihydroxypropyl ester (9.0%), 2,3-dihydroxypropyl elaidate (7.0%), n-propyl 9,12,15-octadecatrienoate (6.0%) are the major components. After 4 weeks of oil uptake, the results revealed an improvement in cardiac function, a decrease in apoptosis, and simultaneous prevention of myocardial fibrosis. The levels of BNP, NT-pro-BNP, endothelin-1, Lp-PLA2, and MMP2, and cTnI and cTn were significantly decreased, and a higher plasma level of Topo 2B was observed, moreover, miRNA − 1 and 29b were downregulated. Current evidence provide insight into the mechanism of flaxseed oil to restore cardiac remodeling, which supports its future application as cardioprotective against heart diseases.
Cardiovascular disease (CVDs) is a leading cause of disability and premature mortality throughout the world [1]. The prevalent case of total CVDs was shifted from 271 million cases in 1990 to 523 million cases in 2019. The global trend of years lived with a disability doubled from 17.7 million to 34.4 million over that period [2]. According to WHO estimates, 17.9 million people died from CVDs in 2019, accounting for 32% of all fatalities. Heart attack and stroke deaths accounted for 85% of these fatalities. Hence, there is an urgent need to focus on adopting existing low-cost public health programs to promote healthy aging throughout the lifetime and minimize disability and premature death from CVD [3].
Frequently cardiovascular remodeling leads to myocardial fibrosis, which can cause heart failure disease (HFD) [4]. Myocardial fibrosis is brought on by elevated myofibroblast activity and increased extracellular matrix deposition. Various cells and substances are involved in this process, and they may serve as targets for potential future medicinal therapies [5]. Proptosis is a kind of inflammation with programmed cell death, it causes cell expansion, rupture of the plasma membrane, the release of cell contents, and sends pro-inflammatory signals to adjacent cells which promote inflammatory responses [6]. According to reported literature, proptosis can cause cardiac remodeling and myocardial dysfunction. Therefore, targeting proptosis has a good prospect of improving cardiac remodeling in HFD [7].
Linum usitatissimum L. (flaxseed or linseed) reaches back to prehistoric times that directly refers to historical significance and wide applications, the generic name Linum derives from the Celtic word line, which means thread, and the species name usitatissimum, means very useful [8, 9]. The geographical origin of the plant has been attributed to the Mediterranean and Southwest Asia [10]. Flaxseed is one of the oldest crops, that has been cultivated in Egypt and Samaria since at least 5000 BC, and the ancient Egyptians utilized plant in medicine and food [11]. The flax therapeutic properties are observed in Hippocrates, Qantas, and Discords works [12].
According to archeological evidence, flax was initially used for fiber and continues to be widely grown for oil [13]. The flax-based products represent the highest potential for growth in the functional food business [14]. Since it has been reported to assist in improving human health and alleviating symptoms associated with a wide range of human ailments, such as cardiovascular, gastrointestinal, and neural disorders [15, 16]. The value of global linseed production represented 1.8 and 8.7 million tons, worldwide in 2011 and 2016 [17]. https://www.statista.com/statistics/916996/linseed-production-global/.
Flaxseed is the richest source of essential omega-3-fatty acid; α-linolenic acid (ALA, 57%) and it is gaining recognition as a functional food [18, 19]. Previous reports indicated that flaxseed supplements can suppress atherosclerosis and have a hypo cholesterol emic effect [20, 21].
The Food Directorate of Health Canada found that a claim relating the intake of ground whole flaxseed with blood cholesterol reduction was acceptable based on the weight of evidence from human clinical studies available prior to 2011 [22]. Hence, clinical studies have revealed that flaxseed can lower serum total and low-density lipoprotein cholesterol, inhibit inflammation markers, and raise serum levels of eicosatetraenoic acid [23]. Flaxseed fiber was also added to bread to lower cholesterol in diabetic patients [24]. Moreover, in young healthy adults, the plasma LDL cholesterol was lowered by 8
Extraction and fractionation of flaxseed oil
The flaxseed (500 g) was grounded to about 0.8 mm particle size (18–20 mesh) and macerated with dichloromethane: methanol (1:1) for 72 hours. The filtrate was concentrated using a rotary evaporator and 250 ml oil was collected and dried over anhydrous sodium sulfate. The fixed oil was fractionated over the Diaion column (5×50 cm) and the methanol fraction was transferred to amber-colored vials, sealed, and stored in a refrigerator until required.
Analysis of essential oils (EOs)
The fixed oil fraction was analyzed by GC-MS (Shimadzu GCMS-QP 2010, Koyoto, Japan) equipped with Rtx-5MS capillary column (30 m length × 0.25 mm i.d. × 0.25 µm film thickness) (Restek, Bellefonte, PA, USA). The oven temperature was kept at 50 ◦C for 2 min (isothermal) and programmed to 300 ◦C at 5 ◦C/min and kept constant at 300 ◦C for 10 min (isothermal); the injector temperature was 280 ◦C. Helium was used as a carrier gas with a constant flow rate set at 1.37 mL/min. Diluted samples (1% v/v) were injected with a split ratio of 30:1, and the injected volume was 1 µL. Ion source temperature: 300 ◦C; EI mode: 70 eV; scan range: 35–500 amu. Each sample was analyzed in triplicate. The mass spectrum of every chemical constituent was compared with the corresponding reported spectrum (in NIST, Wiley Mass Spectral Database − 1995, and ADAMS-2007 libraries) for GC-MS and published references. Identification of compounds was also confirmed by comparing their retention indices (RI) relative to n-alkanes (C8-C20) with reported values in the literature including Adamís library.
Animal treatments and experiments
Forty mature albino rats, each weighing 160 ± 10 g, were provided from Cairo University, National cancer institute. Animals were housed in polypropylene cages with a natural light-dark cycle and humidity levels that were set to industry standards. Animals were given unlimited access to regular pellets and water. As shown in Table 1, the rats were divided into four groups of ten rats each at random.
| Group | Treatment description | |
|---|---|---|
| (I) | Normal control | A typical diet over the period of four weeks |
| (II) | ISO | ISO (85 mg/kg) on day 29 and 30 |
| (III) | ISO + Flaxseed | ISO (85 mg/kg) on day 29 and 30 and oil (100 mg/kg) orally for 30 days |
| (IV) | ISO + Omega 3 | ISO (85 mg/kg) on day 29 and 30 and Omega 3 (100 mg/kg) orally for 30 days |
Table 1: Experimental design of treated groups.
According to Gorriti et al., the LD50 of flaxseed oil is above 37 g/kg of body weight, 100 mg/kg was used as flaxseed dose (3×10− 3 of lethal dose) for in vivo model, the same dose was used for omega 3 as standard drug [40]. The fasted rats were decapitated 24 hours after the last ISO doses, and blood was obtained using sodium fluoride as an anticoagulant. Fresh plasma was then used to estimate BNP, NT-pro-BNP, CTNI, and CTNT according to the kit manufacturer's instructions (Abcam, Cambridge, UK).
Endothelin-1 and Topo 2B were measured using rat ELISA kits in accordance with the manufacturer's instructions from BG Medicine, Waltham, Massachusetts, and Jiangsu Microplate Biotechnology Company in Jiangsu, China, respectively. According to ELISA techniques Kangerke Biotech Co., Ltd., Tianjin, China, and Immunoassay, Atlanta, GA30338, USA, respectively, at 450 nm, plasma levels of Lp-PLA2 and MMP9 were estimated.
Quantitative real-time PCR
Following the manufacturer's recommendations, total RNA was isolated from cardiac tissues using a Sepasol-RNA1Super (Nakarai Tesque), and sections (10–15 g) of the obtained RNA were subjected to real-time quantitative PCR testing. A two-step RT-PCR was used to quantify gene expression. Quantitative real-time PCR was used to measure the levels of miRNA-1 and miRNA29b.PCR buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP, and 0.4 M of specific primers made up the PCR reaction mixture (Table 2). In 50 ml of the single-plex reaction mixture, assays were carried out. Forty cycles of 95 oC for 15 s and 60 o C for 1 min each made up the reaction conditions, which also included a pre-incubation at 50 o C for 2 min and 95 o C for 10 min. The measurements were automatically taken down. Data from quantitative RT-PCR are displayed as a percentage of the control. The internal check was done using U6 mRNA.
| Gene | Primer sequence | Amplicon Size |
|---|---|---|
| miRNA1 | F: 5′-ACACAGAGAGGGCTCCGGCA-3′ R:5′-ACACGACCGTCCACCAACGC-3′ | 342 bp |
| miRNA 29b | F: 5′- -GCT GAG TGTGGCATCCATTT-3 R: 5′- CCACTTCACAAAGCTTTGCAC − 3 | 141bp |
| U6 (internal control for qRT-PCR) | F: ‘5- GCTTCGGCAGCACATATACTAAAAT − 3’R: 5′- CGCTTCACGAATTTGCGTGTCAT − 3’. | 84 bp |
Table 2: Primers used in real-time PCR.
Ten independent determinations for spectrophotometric and ELISA measurements, three separate determinations for analysis of gene expression, and the obtained data were expressed as mean SD. One-way analysis of variance (ANOVA) and the Bonferroni multiple comparison tests were both used by SPSS/20 Software to evaluate the data. Statistics were considered significant when P 0.01 was present.
Characterization and standardization of purified oil fraction by GC-MS analysis revealed the presence of 83 compounds (Table 3), the major constituents were 9,12,15-octadecatrienoic acid, (Z, Z, Z)- (24.69%), oleic acid (10.57%), 9-octadecenoic acid (Z)-, 2,3-dihydroxypropyl ester (9.04%), 2,3-dihydroxypropyl elaidate (7.05%), n-propyl 9,12,15-octadecatrienoate (6.05%), 9-octadecenoic acid, methyl ester (E) (4.45%), and n-hexadecanoic acid (4.02%).
| Peak | R. Time | Area% | Name | Base m/z |
|---|---|---|---|---|
| 1 | 6.246 | 0.01 | Ethanol, 2-butoxy- | 57.10 |
| 2 | 9.019 | 0.02 | Furan, 2-pentyl- | 81.05 |
| 3 | 9.237 | 0.02 | 3-Methyl-but-2-enoic acid, 1,7,7-trimethyl-bicyclo [2.2.1] hept-2-yl ester | 83.10 |
| 4 | 13.112 | 0.01 | Octanoic acid, methyl ester | 74.10 |
| 5 | 18.459 | 0.01 | Rhodium, [1,2-bis(.eta.2-ethenyl)-4-ethenylcyclohexane]di-.mu.-chlorodi- | 121.10 |
| 6 | 18.523 | 0.02 | Furan, 2-hexyl- | 81.05 |
| 7 | 20.894 | 0.01 | n-Caprylic acid isobutyl ester | 127.15 |
| 8 | 21.471 | 0.03 | Nonanoic acid, 9-oxo-, methyl ester | 111.15 |
| 9 | 22.743 | 0.07 | Cycloheptanone, 3-butyl- | 111.15 |
| 10 | 24.584 | 0.02 | Nonanedioic acid, dimethyl ester | 111.15 |
| 11 | 25.555 | 0.07 | Nonanedioic acid, dimethyl ester | 111.15 |
| 12 | 26.557 | 0.03 | Imidazole-5-pentanoic acid | 95.10 |
| 13 | 27.449 | 0.05 | 2-n-Heptylfuran | 81.05 |
| 14 | 28.156 | 0.05 | Azelaaldehydic acid, butyl ester | 109.15 |
| 15 | 29.276 | 0.01 | Heptadecanoic acid, 16-methyl-, methyl ester | 87.10 |
| 16 | 30.011 | 0.02 | Tetradecanoic acid | 129.15 |
| 17 | 30.748 | 0.02 | Nonanedioic acid, dimethyl ester | 125.15 |
| 18 | 32.569 | 0.02 | Imidazole-5-pentanoic acid | 95.10 |
| 19 | 33.638 | 1.50 | Hexadecanoic acid, methyl ester | 87.10 |
| 20 | 34.493 | 4.02 | n-Hexadecanoic acid | 73.10 |
| 21 | 35.020 | 0.01 | Decanoic acid, 2,4,6-trimethyl-, methyl ester | 88.10 |
| 22 | 36.850 | 2.07 | 9,12-Octadecadienoic acid (Z,Z)-, methyl ester | 81.10 |
| 23 | 36.933 | 2.94 | 9,12,15-Octadecatrienoic acid, methyl ester, (Z,Z,Z)- | 79.10 |
| 24 | 37.053 | 4.45 | 9-Octadecenoic acid, methyl ester, (E)- | 97.15 |
| 25 | 37.126 | 0.22 | 9-Octadecenoic acid, methyl ester, (E)- | 97.15 |
| 26 | 37.589 | 2.55 | Methyl stearate | 87.10 |
| 27 | 37.995 | 24.69 | 9,12,15-Octadecatrienoic acid, (Z,Z,Z)- | 79.10 |
| 28 | 38.095 | 10.57 | Oleic Acid | 83.15 |
| 29 | 38.419 | 2.63 | Octadecanoic acid | 43.10 |
| 30 | 38.734 | 2.71 | Hexadecanoic acid, butyl ester | 56.10 |
| 31 | 38.860 | 0.05 | Heptadecanoic acid, ethyl ester | 88.10 |
| 32 | 39.985 | 0.06 | Ether, (2-ethyl-1-cyclodecen-1-yl)methyl methyl | 125.15 |
| 33 | 40.138 | 0.07 | (Z,Z,Z)-6,9,15-Octadecatrienoic acid methyl ester | 95.15 |
| 34 | 40.216 | 0.09 | 9-Octadecenoic acid, 12-hydroxy-, methyl ester, (Z)- | 95.10 |
| 35 | 40.685 | 0.05 | cis-Methyl 11-eicosenoate | 97.15 |
| 36 | 40.874 | 0.27 | 9,12-Octadecadien-1-ol, (Z,Z)- | 81.10 |
| 37 | 40.951 | 0.42 | 9,12,15-Octadecatrienoic acid, ethyl ester, (Z,Z,Z)- | 79.10 |
| 38 | 41.026 | 0.51 | Octyl cis-vaccenate | 97.15 |
| 39 | 41.140 | 0.03 | 5,5,8a-Trimethyldecalin-1-one | 111.15 |
| 40 | 41.209 | 0.07 | Eicosanoic acid, methyl ester | 87.10 |
| 41 | 41.274 | 0.05 | 13-Docosenamide, (Z)- | 72.10 |
| 42 | 41.598 | 3.22 | 9-Octadecen-1-ol, acetate, (Z)- | 81.10 |
| 43 | 41.689 | 6.05 | n-Propyl 9,12,15-octadecatrienoate | 79.10 |
| 44 | 41.771 | 7.05 | 2,3-Dihydroxypropyl elaidate | 83.10 |
| 45 | 41.846 | 0.29 | cis-9-Octadecenoic acid, propyl ester | 97.15 |
| 46 | 42.236 | 1.89 | Octadecanoic acid, butyl ester | 56.10 |
| 47 | 42.689 | 0.03 | Cedrol | 95.10 |
| 48 | 43.352 | 0.01 | Glycidyl (Z)-9-nonadecenoate | 129.10 |
| 49 | 43.780 | 0.97 | Hexadecanoic acid, 2-hydroxy-1-(hydroxymethyl)ethyl ester | 98.10 |
| 50 | 43.935 | 0.10 | Hexadecanoic acid, 2-hydroxy-1-(hydroxymethyl)ethyl ester | 98.10 |
| 51 | 44.063 | 0.06 | 6-Octadecenoic acid, methyl ester, (Z)- | 97.15 |
| 52 | 44.407 | 0.18 | Bis(2-ethylhexyl) phthalate | 149.05 |
| 53 | 44.520 | 0.11 | Heptadecanoic acid, 16-methyl-, methyl ester | 87.10 |
| 54 | 44.606 | 0.09 | 4H-Cyclopentacycloocten-4-one, decahydro- | 95.10 |
| 55 | 44.754 | 0.05 | 2-Buten-1-ol, 2-ethyl-4-(2,2,3-trimethyl-3-cyclopenten-1-yl)- | 121.15 |
| 56 | 45.000 | 0.07 | cis-13-Eicosenoic acid | 97.15 |
| 57 | 45.454 | 0.12 | Arachidic acid, butyl ester | 56.10 |
| 58 | 46.641 | 9.04 | 9-Octadecenoic acid (Z)-, 2,3-dihydroxypropyl ester | 98.15 |
| 59 | 46.722 | 0.98 | E,E,Z-1,3,12-Nonadecatriene-5,14-diol | 95.15 |
| 60 | 47.011 | 0.64 | Hexadecanedioic acid, dimethyl ester | 98.15 |
| 61 | 47.145 | 0.09 | Octadecanoic acid, 2,3-dihydroxypropyl ester | 98.15 |
| 62 | 47.604 | 0.05 | Tetracosanoic acid, methyl ester | 87.10 |
| 63 | 48.062 | 0.11 | Erucic acid | 97.15 |
| 64 | 48.460 | 0.06 | Docosanoic acid | 56.10 |
| 65 | 49.033 | 0.02 | 2,2,4-Trimethyl-3-(3,8,12,16-tetramethyl-heptadeca-3,7,11,15-tetraenyl)-cyclohexanol | 81.10 |
| 66 | 49.621 | 0.03 | E,E,Z-1,3,12-Nonadecatriene-5,14-diol | 95.15 |
| 67 | 49.996 | 0.02 | 1-Heptacosanol | 97.15 |
| 68 | 50.467 | 0.02 | Heptadecanoic acid, 16-methyl-, methyl ester | 87.10 |
| 69 | 51.459 | 0.02 | (-)-Globulol | 81.10 |
| 70 | 52.675 | 0.02 | 5-.alpha.-Androst-2-en-17-.beta.-ol, 17-methyl- | 105.10 |
| 71 | 53.383 | 0.03 | Andrographolide | 109.15 |
| 72 | 54.152 | 0.07 | Retinoic acid, methyl ester | 107.15 |
| 73 | 54.325 | 1.40 | Ergost-5-en-3-ol, (3.beta.)- | 107.10 |
| 74 | 54.788 | 0.48 | Humulenol-II | 83.15 |
| 75 | 55.414 | 0.03 | Andrographolide | 105.10 |
| 76 | 55.765 | 2.50 | gamma.-Sitosterol | 107.10 |
| 77 | 55.939 | 0.18 | Cholest-5-en-3-ol, 24-propylidene-, (3.beta.)- | 105.10 |
| 78 | 56.238 | 0.20 | 6.beta.Bicyclo[4.3.0]nonane,5.beta.-iodomethyl-1.beta.-isopropenyl-4.alpha.,5.alpha.- | 109.15 |
| 79 | 56.601 | 0.02 | 6.beta.Bicyclo[4.3.0]nonane,5.beta.-iodomethyl-1.beta.-isopropenyl-4.alpha.,5.alpha.- | 121.15 |
| 80 | 56.954 | 2.27 | 6.beta.Bicyclo[4.3.0]nonane,5.beta.-iodomethyl-1.beta.-isopropenyl-4.alpha.,5.alpha.- | 95.10 |
| 81 | 57.344 | 0.01 | Azulene, 1,2,3,3a,4,5,6,7-octahydro-1,4-dimethyl-7-(1-methylethenyl)-, [1R-(1. alpha) | 107.10 |
| 82 | 57.936 | 0.02 | Pregn-4-ene-3,20-dione, (9. beta.,10.alpha.)- | 124.10 |
| 83 | 58.060 | 0.03 | 6.beta. Bicyclo [4.3.0]nonane, 5.beta.-iodomethyl-1.beta.-isopropenyl-4.alpha.,5.alpha.- | 95.15 |
Table 3: GC-MS of purified flaxseed oil fraction.
The result indicates that 9,12,15-octadecatrienoic acid, (Z, Z, Z); alpha-linolenic acid (ALA) is represented as 9.8% of extracted crude oil and 4.8% of total flaxseed weight. ALA (18:3n-3) is an 18-carbon atoms carboxylic acid with three cis double bonds and consider an essential fatty acid indispensable to the human body. It is characterized by anti-inflammatory, anti-obesity, neuroprotection, anticancer, antioxidant, and anti-metabolic syndrome. It can convert into eicosapentaenoic acid and docosahexaenoic acid in the body. However, this conversion is limited and affected by many factors such as gender, dose, and disease [41].
The synthetic catecholamine and b-adrenergic agonist isoproterenol (ISO), also known as 1-(3, 4-dihydroxyphenyl)-2-isopropylamino ethanol hydrochloride, causes a large amount of oxidative stress in the myocardium and causes infarct-like necrosis of the heart muscle [42]. Through autooxidation, it produces highly cytotoxic free radicals that speed up the peroxidation of membrane phospholipids and seriously damage the heart membrane [43].
The findings indicates that group II animals had plasma BNP and NT-pro-BNP levels that were significantly increased to 207.34% and 372.51%, respectively (p Less than 0.01) compared to group I (Figure 1). Additionally, when compared to group II, the administration of flaxseed oil caused a significant decrease in plasma BNP and NT-pro-BNP levels by 32.02% and 52.14%, respectively (p Less than 0.01). However, when compared to group II, the BNP and NT-pro-BNP levels in group IV significantly dropped by 42.38% and 57.3%, respectively (p Less than 0.01).

Figure 1: Effect of flaxseed oil on plasma BNP and NT-pro-BNP in isoproterenol treated rats. Data are represented as mean value (pg/mL). Data followed by the same letter within the same parameter are not significantly different at P Less than or Equal to 0.05.
In contrast to the group I, Group II had significantly increased plasma levels of endothelin-1, Lp-PLA2, and MMP9 to 248.33%, 148.50%, and 179.33% as well as significantly lower plasma levels of topo 2B by 63.9% (p Less than 0.01) (Figure 2).

Figure 2: Effect of flaxseed oil on plasma Endothelin-1, Topo 2B, Lp-PLA2 and MMP9 in isoproterenol treated rats. Data shown are mean ± standard deviation of number of observations within each treatment. The tested flaxseed oil was orally given daily for 4 weeks at 100 mg/kg. Data followed by the same letter are not significantly different at P Less than or Equal to 0.05.
Additionally, when compared to group II, the administration of flaxseed oil significantly increased plasma levels of topo 2B to 206.84% (p Less than 0.01) while significantly decreasing plasma endothelin-1, Lp-PLA2, and MMP9 levels by 38.05%, 18.51%, and 22.85%, respectively. In group IV endothelin-1, Lp-PLA2, and MMP9 levels considerably decreased by 42.69, 24.20, and 30.64%, respectively, as well as a significantly increase of plasma topo 2B level to 257.33% (p Less than 0.01) was observed.
According to the findings, group II animals had plasma cTnI and cTnT levels that were significantly higher than those of group I by 211.76 and 196.42%, respectively (p Less than 0.01). Additionally, when compared to group II, the administration of flaxseed oil caused a substantial drop in plasma cTnI and cTn T levels by 43.05 and 33.63%, respectively (p Less than 0.01). When compared to group II, the levels of cTnI and cTn T in group IV significantly dropped by 47.22 and 37.30%, respectively (p Less than 0.01) Figure 3.

Figure 3: Effect of flaxseed oil on cardiac troponin I (cTnI) and troponin T (cTn T) in isoproterenol treated rats. Data shown are mean ± standard deviation of number of observations within each treatment. The tested flaxseed oil was orally given daily for 4 weeks at 100 mg/kg. Data followed by the same letter are not significantly different at P Less than or Equal to 0.05.
In Figures 4 and 5, a significant increase in plasma miRNA1 and miRNA29b expression levels was detected obviously in group II animals in contrast to the normal group I (211.81% and 379.09%, respectively). However, group III had a significant decrease in plasma miRNA1 and miRNA29b gene expression levels (p Less than 0.01), by 41.17% and 45.08%, respectively as compared to group II. On the other hand, miRNA1 and miRNA29b gene expression levels decreased significantly by 47.06% and 50.6%, respectively in group IV compared to group II (p Less than 0.01).

Figure 4: Effect of flaxseed oil on plasma miRNA1 gene expression in isoproterenol treated rats. Data followed by the same letter are not significantly different
In the recent decade, essential fatty acids (EFAs) have become the primary focus of scientific research with substantial research, as a crucial metabolite in the field of cardiac medicine [44]. Despite this progress, the molecular mechanisms of action, and their exact physiological ability that prevents associated cardiovascular diseases are still unanswered [45].
Kaithwas et al., reported that flax oil comparable to aspirin where it exhibits dose-dependent inhibition of protein exudation vascular permeability, and leukocyte migration in pleural exudates [30]. As the eicosanoids, EPA derived from linolenic acid metabolism account for the production of lets vasodilatory (PGE3) and chemotactic (LTB5). The current study describes the primary biological mechanisms and genetic modification of how flaxseed oil-rich ALA, could have a cardiac protective effect against cardiac remodeling in an ISO-induced vivo model.
BNP and NT-proBNP are commonly used as key indicators for the clinical diagnosis of HF and cardiac dysfunction [46, 47]. Previous studies have demonstrated the use of BNP and NT-proBNP as postmortem biomarkers in forensic medicine to identify cardiac dysfunction. These investigations used comprehensive animal experiments and postmortem tissues to represent the cardiac activity of the deceased before death [48, 49]. This result revealed that flaxseed oil-rich ALA inhibits BNP, and NT-pro-BNP, and reduces apoptosis, and cardiac fibrosis.
Increased levels of endothelin-1, Lp-PLA2, and MMP9 have been linked to different heart conditions, including hypertension, interferon-induced chronic active myocarditis, cardiomyopathy, streptozotocin-induced diabetic cardiomyopathy, pulmonary artery banding-induced HF in both the left (RV) and right (LV) heart [50, 51]. In the present study, elevation levels of Endothelin-1, Lp-PLA2, and MMP9 as well as depletion of plasma Topo 2B have been observed in heart disease animal models after ISO administration. Moreover, compared to controls, ISO-treated rats showed an increase in ET-1, Lp-PLA2, and MMP9 plasma levels, which indicates that ISO induces cardiac tissue inflammation. It is tempting to speculate that these mediators' increased expression is accessible to myocardial toxicity and can promote inflammation and activation of vascular smooth muscle cells. This result is in accordance with the Kaithwas et al., a study that reported the anti-inflammatory activity of flaxseed oil (57.38%, ALA) [33].
According to early studies examining Top2a and Top2b's differential expression, Kondapi, and colleagues discovered that Topo 2B lower expression is associated with aging in an adult rat's whole brain preparation when compared to its younger counterpart [52]. More particular, the cerebellum and cerebellar area showed a decrease in protein expression. This was further supported by the observation that Top2B activity declined with age in sheep neural cell preparation [53, 54].
Aging and sex hormone deprivation is considered the primary factor of cardiac remodeling, while the heart “shrinking” with an increase in heart rate, smaller ventricular volumes, and changes in LV morphology are observed [55]. Hence, the investigation of Topo 2B levels in ISO-treated rats was important. Our results showed a reversible correlation between Topo 2B and cardiac inflammation while plasma Topo 2B levels were significantly decreased in ISO-treated rats. The administration of flaxseed oil increased the level of plasma Topo 2B with subsequent inhibition of inflammation and improvement of cardiac tissue. Flaxseed oil delivery raises plasma levels of cTnI and cTnT compared to the treated group with ISO. These outcomes were consistent with the previous results that referred to the inhibition of cTnI and cTnT plasma protein expression in the CVD animal model treated with ISO [56, 57]. Hence, the reported anti-inflammatory effect of flaxseed oil [33] could be attributed to its biological modifying effect on cTnI and cTnT receptor cells.
The biological functions of miR-1 and miR-29 in ISO-induced cardiac damage are indicated in the current study. According to earlier research, MiR-1 and miR-29 were found to be involved in heart morphogenesis in a mouse model [58]. The upregulation of miR-29 level has been shown by investigations on liver, lung, and kidney fibrosis disease [59]. Indeed, it has been reported that ISO-treated groups have higher levels of miR-1 and miR-29 expression than normal rats [60, 61]. Moreover, all major types of cardiovascular cells, including vascular smooth muscle cells (VSMCs) [62], endothelial cells [63], cardiomyocytes [64], and cardiac fibroblasts [65, 66] have been reported to have significant levels of miR-1 and miR-29 expression. Contrary, according to the current study, ALA-rich flaxseed oil protected the heart by decreasing the levels of miRNA-1 and miRNA-29b genes expression.
The current study provides experimental evidence that the standardized flaxseed oil fraction can improve cardiac function after ISO-induced cardiotoxicity. The finding clarified the molecular mechanism as well as the benefit of oil as a cardioprotective drug candidate against cardiac remodeling for lowering the incidence of cardiovascular risk factors and mortality. The flaxseed oil downregulated BNP, NT-pro-BNP, endothelin-1, Lp-PLA2, and MMP2, as well as cTnI and cTn plasma levels and upregulated Topo 2B. It also down-regulated the expression of miRNA-1 and miRNA-29b genes. Future research for preparation proper formulation and clinical investigation are recommended to ascertain the impact of bioavailability, dose, gender, and other diseases on the pharmacokinetics of flaxseed-rich ALA oil.

Author Contributions: S.A.B and J.A.N are equally contributed.
Funding: Not applicable
Data Availability: All data generated or analyzed for this study are included in this published article.
Competing Interests: the authors declare no competing interests.
Ethics Approval: The study was carried out according to the guidelines of October 6 University and approved by the Ethics Committee of the Faculty of Applied Medical Science (protocol code: 20220301 and date of approval: 1/3/2022).
Consents Participate: Not applicable.
Consents Publish: All authors have given consentto publish the manuscript in Plant Foods for Human Nutrition.
Conflict of Interest: The authors declare no conflicts of interests.
Additional Declarations: No competing interests reported.
“I would like to express my sincere gratitude to Ms. Sarah Jacobs, Editorial Coordinator of the IJCCR, for her excellent collaboration and exceptional support throughout the entire process, from article submission and peer review to financial matters and successful publication. Everything went very quickly and smoothly. I would also like to thank the reviewers, whose comments were helpful and contributed to an even better article. I wholeheartedly recommend this deservedly renowned journal to my colleagues for publication.” Best regards, Andreas Schapowal.
Dear Editorial Team, Clinical Medical Reviews and Reports. My experience with the journal was highly positive. The peer-review process was rigorous, constructive, and completed in a timely manner. The reviewers provided valuable comments that helped improve the quality and clarity of our manuscript. The editorial office was professional, responsive, and supportive throughout all stages of the publication process. Communication was clear and efficient, and any questions were addressed promptly. Overall, I found the journal to maintain high scientific standards and an excellent publication workflow. I would be pleased to consider submitting future work to this journal. Best wishes from, Elena Popa.
It was my pleasure to submit my testimonial concerning the Reviewer Board of our Scientific Journal “Brain and Neurological Disorders”. The Reviewers focused on some modifications and their contribution was helpful. The ladies of our Editorial Office were also supported my efforts. It was my honor to have such a co-operation and I am looking forward for more collaboration.
Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Thank you for the speedy and efficient peer review process. I appreciate the fact that your peer reviewers do not take months to respond like with some other journals. I would also like to thank the editorial office for responding quickly to my questions. It is an excellent journal. I plan to submit more manuscripts in the future. Best wishes from, Robert W. McGee
Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Working with you and your team on our recent publication in JCRR has been a truly wonderful and enjoyable experience. The responses were prompt, and the reviewers were patient, constructive, and highly professional. One reviewer in particular gave me the feeling that a professor was carefully reading and commenting on my coursework, which was deeply touching. The entire process was straightforward and hassle‑free, with no tedious online forms to complete. I highly recommend this journal. Best wishes from, DR Aibing Rao, Head of R&D
I Appreciate the Opportunity to Share my Experience with the Journal of Clinical Research and Reports. The peer review process was timely and constructive, and the feedback provided helped improve the quality of our manuscript. The editorial office was professional, responsive, and supportive throughout the process, ensuring smooth communication and efficient handling of the submission. Overall, it was a positive experience collaborating with your team.
Dear Mercy Grace, Editorial Coordinator of Obstetrics Gynecology and Reproductive Sciences, We would like to express our gratitude for your help at all stages of publishing and editing the article. The editors of the magazine answer all the necessary questions and help at every stage. We will definitely continue to cooperate and publish other works in the Obstetrics Gynecology and Reproductive Sciences! Best wishes from, Alla Konstantinovna Politova,
Dear Maria Emerson, Editorial Coordinator of International Journal of Clinical Case Reports and Reviews, What distinguishes International Journal of Clinical Case Report and Review is not only the scientific rigor of its publications, but the intellectual climate in which research is evaluated. The submission process is refreshingly free of unnecessary formal barriers and bureaucratic rituals that often complicate academic publishing without adding real value. The peer-review system is demanding yet constructive, guided by genuine scientific dialogue rather than hierarchical or authoritarian attitudes. Reviewers act as collaborators in improving the manuscript, not as gatekeepers imposing arbitrary standards. This journal offers a rare balance: high methodological standards combined with a respectful, transparent, and supportive editorial approach. In an era where publishing can feel more burdensome than research itself, this platform restores the original purpose of peer review — to refine ideas, not to obstruct them Prof. Perlat Kapisyzi, FCCP PULMONOLOGIST AND THORACIC IMAGING.
Dear Reader: We have published several articles in the Auctores Publishing, LLC, journal, Clinical Medical Reviews and Reports in recent years (CMRR). This is an ‘open access’ journal and the following are our observations. From the initial invitation to submit an article, to the final edits of galley proofs, we have found CMRR personnel to be professional, responsive, rapid and thorough. This entire process begins with Catherine Mitchell, Editorial Coordinator. She is simply outstanding, and, I believe, unparalleled in her capacity. I cannot imagine a more responsive and dedicated Editorial Coordinator. As I read the dates and timing of her correspondence with us, it seems that she never sleeps. I hope Auctores Publishing, LLC, appreciates her efforts as much as these authors do. Thank you to Auctores Publishing, LLC, to the Editorial Staff/Board, and to Catherine Mitchell from a grateful author(s).
Dear Maria Emerson, Editorial Coordinator of - Journal of Clinical Research and Reports. ''I am pleased to provide this testimonial following the publication of our recent case report in this journal. The peer review process was rigorous, constructive, thorough, and conducted in a timely manner. The reviewers’ comments were thoughtful, detailed, and highly constructive, contributing substantially to the refinement, clarity, and scientific robustness of our manuscript. The process was conducted with professionalism and academic integrity throughout. The support provided by the editorial office was exemplary. Communication was consistently prompt, clear, and courteous at all stages of the submission and publication process. The editorial team demonstrated a high level of organization and responsiveness, ensuring that all queries were addressed efficiently and that the process remained transparent and well-coordinated. The overall quality of the journal is reflected in its strong editorial standards, commitment to scientific excellence, and dedication to publishing clinically meaningful research. It has been a privilege to publish our work in this journal, and we would welcome the opportunity to contribute further in the future.'' Best wishes from, Dr. Efstratios Trogkanis, Cardiologist.
Dear Grace Pierce, Editorial Coordinator of the journal IJCCR, I had a very positive experience with Auctores - Journal throughout the publication process. The Editorial Team was highly responsive, professional, and supportive at every stage. I would like to extend my sincere thanks to the Editor: Grace Pierce, for her guidance and assistance. The peer-review process was smooth and constructive, helping improve the quality of my work. I would gladly recommend Auctores Journal to fellow researchers and authors. Dr. SABITA SINHA, Medical Oncologist, MD (Electro Homeopathy).
Dear Mayra Duenas, Editorial Coordinator of the journal IJCCR, I write here a little on my experience as an author submitting to the International Journal of Clinical Case Reports and Reviews (IJCCR). This was my first submission to IJCCR and my manuscript was inherently an outsider’s effort. It attempted to broadly identify and then make some sense of life’s under-appreciated mysteries. I initially had responded to a request for possible submissions. I then contacted IJCCR with a tentative topic for a manuscript. They quickly got back with an approval for the submission, but with a particular requirement that it be medically relevant. I then put together a manuscript and submitted it. After the usual back-and-forth over forms and formality, the manuscript was sent off for reviews. Within 2 weeks I got back 4 reviews which were both helpful and also surprising. Surprising in that the topic was somewhat foreign to medical literature. My subsequent updates in response to the reviewer comments went smoothly and in short order I had a series of proofs to evaluate. All in all, the whole publication process seemed outstanding. It was both helpful in terms of the paper’s content and also in terms of its efficient and friendly communications. Thank you all very much. Sincerely, Ted Christopher, Rochester, NY.
International Journal of Clinical Case Reports and Reviews is a high quality journal that has a clear and concise submission process. The peer review process was comprehensive and constructive. Support from the editorial office was excellent, since the administrative staff were responsive. The journal provides a fast and timely publication timeline.
Dear Cecilia Lilly, Editorial Coordinator, Endocrinology and Disorders, Thank you so much for your quick response regarding reviewing and all process till publishing our manuscript entitled: Prevalence of Pre-Diabetes and its Associated Risk Factors Among Nile College Students, Sudan. Best regards, Dr Mamoun Magzoub.
Dear Editorial Team, Clinical Cardiology and Cardiovascular Interventions. I am really grateful for the peers review; their feedback gave me the opportunity to reflect on the message and impact of my work and to ameliorate the article. The editors did a great job in addition by encouraging me to continue with the process of publishing.
Dear Mayra Duenas, Editorial Coordinator of ‘International Journal of Clinical Case Reports and Reviews Herewith I confirm an optimal peer review process and a great support of the editorial office of the present journal
Dear Maria Emerson, Editorial Coordinator of ‘International Journal of Clinical Case Reports and Reviews’, I appreciate the opportunity to publish my article with your journal. The editorial office provided clear communication during the submission and review process, and I found the overall experience professional and constructive. Best regards, Elena Salvatore.
Dear Editorial Team, Journal-Clinical Cardiology and Cardiovascular Interventions, “Publishing my article with Clinical Cardiology and Cardiovascular Interventions has been a highly positive experience. The peer-review process was rigorous yet supportive, offering valuable feedback that strengthened my work. The editorial team demonstrated exceptional professionalism, prompt communication, and a genuine commitment to maintaining the highest scientific standards. I am very pleased with the publication quality and proud to be associated with such a reputable journal.” Warm regards, Dr. Mahmoud Kamal Moustafa Ahmed
Dear Editorial Team, Clinical Cardiology and Cardiovascular Interventions. It was truly a rewarding experience to work with the journal “Clinical Cardiology and Cardiovascular Interventions”. The peer review process was insightful and encouraging, helping us refine our work to a higher standard. The editorial office offered exceptional support with prompt and thoughtful communication. I highly value the journal’s role in promoting scientific advancement and am honored to be part of it. Best regards, Meng-Jou Lee, MD, Department of Anesthesiology, National Taiwan University Hospital.
Dear Maria Emerson, Editorial Coordinator, Journal of Clinical Research and Reports. Thank you for publishing our case report: "Clinical Case of Effective Fetal Stem Cells Treatment in a Patient with Autism Spectrum Disorder" within the "Journal of Clinical Research and Reports" being submitted by the team of EmCell doctors from Kyiv, Ukraine. We much appreciate a professional and transparent peer-review process from Auctores. All research Doctors are so grateful to your Editorial Office and Auctores Publishing support! I amiably wish our article publication maintained a top quality of your International Scientific Journal. My best wishes for a prosperity of the Journal of Clinical Research and Reports. Hope our scientific relationship and cooperation will remain long lasting. Thank you very much indeed. Kind regards, Dr. Andriy Sinelnyk Cell Therapy Center EmCell
I recommend without hesitation submitting relevant papers on medical decision making to the International Journal of Clinical Case Reports and Reviews. I am very grateful to the editorial staff. Maria Emerson was a pleasure to communicate with. The time from submission to publication was an extremely short 3 weeks. The editorial staff submitted the paper to three reviewers. Two of the reviewers commented positively on the value of publishing the paper. The editorial staff quickly recognized the third reviewer’s comments as an unjust attempt to reject the paper. I revised the paper as recommended by the first two reviewers.
Dear Chrystine Mejia, Editorial Coordinator, Journal of Neurodegeneration and Neurorehabilitation. “The peer review process was efficient and constructive, and the editorial office provided excellent communication and support throughout. The journal ensures scientific rigor and high editorial standards, while also offering a smooth and timely publication process. We sincerely appreciate the work of the editorial team in facilitating the dissemination of innovative approaches such as the Bonori Method.” Best regards, Dr. Matteo Bonori.
Dear Maria Emerson, Editorial Coordinator, we have deeply appreciated the professionalism demonstrated by the International Journal of Clinical Case Reports and Reviews. The reviewers have extensive knowledge of our field and have been very efficient and fast in supporting the process. I am really looking forward to further collaboration. Thanks. Best regards, Dr. Claudio Ligresti
Dear Ms. Mayra Duenas, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews. “The International Journal of Clinical Case Reports and Reviews represented the “ideal house” to share with the research community a first experience with the use of the Simeox device for speech rehabilitation. High scientific reputation and attractive website communication were first determinants for the selection of this Journal, and the following submission process exceeded expectations: fast but highly professional peer review, great support by the editorial office, elegant graphic layout. Exactly what a dynamic research team - also composed by allied professionals - needs!" From, Chiara Beccaluva, PT - Italy.
Dear Clarissa Eric, Editorial Coordinator, Journal of Clinical Case Reports and Studies, Auctores Publishing LLC, USA Office: +1-(302)-520-2644. I would like to express my sincere appreciation for the efficient and professional handling of my case report by the ‘Journal of Clinical Case Reports and Studies’. The peer review process was not only fast but also highly constructive—the reviewers’ comments were clear, relevant, and greatly helped me improve the quality and clarity of my manuscript. I also received excellent support from the editorial office throughout the process. Communication was smooth and timely, and I felt well guided at every stage, from submission to publication. The overall quality and rigor of the journal are truly commendable. I am pleased to have published my work with Journal of Clinical Case Reports and Studies, and I look forward to future opportunities for collaboration. Sincerely, Aline Tollet, UCLouvain.
Dear Chrystine Mejia, Editorial Coordinator, Journal of Neurodegeneration and Neurorehabilitation, Auctores Publishing LLC, We would like to thank the editorial team for the smooth and high-quality communication leading up to the publication of our article in the Journal of Neurodegeneration and Neurorehabilitation. The reviewers have extensive knowledge in the field, and their relevant questions helped to add value to our publication. Kind regards, Dr. Ravi Shrivastava.
Dear Clarissa Eric, Editorial Coordinator, Journal of Clinical Case Reports and Studies, I would like to express my deep admiration for the exceptional professionalism demonstrated by your journal. I am thoroughly impressed by the speed of the editorial process, the substantive and insightful reviews, and the meticulous preparation of the manuscript for publication. Additionally, I greatly appreciate the courteous and immediate responses from your editorial office to all my inquiries. Best Regards, Dariusz Ziora
Dear Ashley Rosa, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews, Auctores Publishing LLC. Thank you for publishing our article, Exploring Clozapine's Efficacy in Managing Aggression: A Multiple Single-Case Study in Forensic Psychiatry in the international journal of clinical case reports and reviews. We found the peer review process very professional and efficient. The comments were constructive, and the whole process was efficient. On behalf of the co-authors, I would like to thank you for publishing this article. With regards, Dr. Jelle R. Lettinga.
Dear Jessica Magne, Editorial Coordinator, Clinical Cardiology and Cardiovascular Interventions, Auctores Publishing LLC. The peer review process of the journal of Clinical Cardiology and Cardiovascular Interventions was excellent and fast, as was the support of the editorial office and the quality of the journal. Kind regards Walter F. Riesen Prof. Dr. Dr. h.c. Walter F. Riesen.
Dear Erin Aust, Editorial Coordinator, Journal of General Medicine and Clinical Practice. We are pleased to share our experience with the “Journal of General Medicine and Clinical Practice”, following the successful publication of our article. The peer review process was thorough and constructive, helping to improve the clarity and quality of the manuscript. We are especially thankful to Ms. Erin Aust, the Editorial Coordinator, for her prompt communication and continuous support throughout the process. Her professionalism ensured a smooth and efficient publication experience. The journal upholds high editorial standards, and we highly recommend it to fellow researchers seeking a credible platform for their work. Best wishes By, Dr. Rakhi Mishra.
Dr Hala Al Shaikh This is to acknowledge that the peer review process for the article ’ A Novel Gnrh1 Gene Mutation in Four Omani Male Siblings, Presentation and Management ’ sent to the International Journal of Clinical Case Reports and Reviews was quick and smooth. The editorial office was prompt with easy communication.
Dear Agrippa Hilda, Editorial Coordinator, Journal of Neuroscience and Neurological Surgery. The entire process including article submission, review, revision, and publication was extremely easy. The journal editor was prompt and helpful, and the reviewers contributed to the quality of the paper. Thank you so much! Eric Nussbaum, MD
Dear Ashley Rosa, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews. Many thanks for publishing this manuscript after I lost confidence the editors were most helpful, more than other journals Best wishes from, Susan Anne Smith, PhD. Australian Breastfeeding Association.
Dear Maria Emerson, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews, Auctores Publishing LLC. I am delighted to have published our manuscript, "Acute Colonic Pseudo-Obstruction (ACPO): A rare but serious complication following caesarean section." I want to thank the editorial team, especially Maria Emerson, for their prompt review of the manuscript, quick responses to queries, and overall support. Yours sincerely Dr. Victor Olagundoye.
Dear Jessica Magne, Editorial Coordinator, Clinical Cardiology and Cardiovascular Interventions, Auctores Publishing LLC. I appreciate the journal (JCCI) editorial office support, the entire team leads were always ready to help, not only on technical front but also on thorough process. Also, I should thank dear reviewers’ attention to detail and creative approach to teach me and bring new insights by their comments. Surely, more discussions and introduction of other hemodynamic devices would provide better prevention and management of shock states. Your efforts and dedication in presenting educational materials in this journal are commendable. Best wishes from, Farahnaz Fallahian.
Dear Ashley Rosa, Editorial Coordinator of the journal - Psychology and Mental Health Care. " The process of obtaining publication of my article in the Psychology and Mental Health Journal was positive in all areas. The peer review process resulted in a number of valuable comments, the editorial process was collaborative and timely, and the quality of this journal has been quickly noticed, resulting in alternative journals contacting me to publish with them." Warm regards, Susan Anne Smith, PhD. Australian Breastfeeding Association.
Dear Jessica, and the super professional team of the ‘Clinical Cardiology and Cardiovascular Interventions’ I am sincerely grateful to the coordinated work of the journal team for the no problem with the submission of my manuscript: “Cardiometabolic Disorders in A Pregnant Woman with Severe Preeclampsia on the Background of Morbid Obesity (Case Report).” The review process by 5 experts was fast, and the comments were professional, which made it more specific and academic, and the process of publication and presentation of the article was excellent. I recommend that my colleagues publish articles in this journal, and I am interested in further scientific cooperation. Sincerely and best wishes, Dr. Oleg Golyanovskiy.
To Dear Erin Aust – Editorial Coordinator of Journal of General Medicine and Clinical Practice! I declare that I am absolutely satisfied with your work carried out with great competence in following the manuscript during the various stages from its receipt, during the revision process to the final acceptance for publication. Thank Prof. Elvira Farina
My article, titled 'No Way Out of the Smartphone Epidemic Without Considering the Insights of Brain Research,' has been republished in the International Journal of Clinical Case Reports and Reviews. The review process was seamless and professional, with the editors being both friendly and supportive. I am deeply grateful for their efforts.
We found the peer review process quick and positive in its input. The support from the editorial officer has been very agile, always with the intention of improving the article and taking into account our subsequent corrections.
Dear Jessica Magne, with gratitude for the joint work. Fast process of receiving and processing the submitted scientific materials in “Clinical Cardiology and Cardiovascular Interventions”. High level of competence of the editors with clear and correct recommendations and ideas for enriching the article.
I thank the ‘Journal of Clinical Research and Reports’ for accepting this article for publication. This is a rigorously peer reviewed journal which is on all major global scientific data bases. I note the review process was prompt, thorough and professionally critical. It gave us an insight into a number of important scientific/statistical issues. The review prompted us to review the relevant literature again and look at the limitations of the study. The peer reviewers were open, clear in the instructions and the editorial team was very prompt in their communication. This journal certainly publishes quality research articles. I would recommend the journal for any future publications.
"I am grateful for the opportunity of contributing to [International Journal of Clinical Case Reports and Reviews] and for the rigorous review process that enhances the quality of research published in your esteemed journal. I sincerely appreciate the time and effort of your team who have dedicatedly helped me in improvising changes and modifying my manuscript. The insightful comments and constructive feedback provided have been invaluable in refining and strengthening my work".
To Dear Erin Aust, I would like to express my heartfelt appreciation for the opportunity to have my work published in this esteemed journal. The entire publication process was smooth and well-organized, and I am extremely satisfied with the final result. The Editorial Team demonstrated the utmost professionalism, providing prompt and insightful feedback throughout the review process. Their clear communication and constructive suggestions were invaluable in enhancing my manuscript, and their meticulous attention to detail and dedication to quality are truly commendable. Additionally, the support from the Editorial Office was exceptional. From the initial submission to the final publication, I was guided through every step of the process with great care and professionalism. The team's responsiveness and assistance made the entire experience both easy and stress-free. I am also deeply impressed by the quality and reputation of the journal. It is an honor to have my research featured in such a respected publication, and I am confident that it will make a meaningful contribution to the field.
I would like to express my sincere gratitude for the support and efficiency provided by the editorial office throughout the publication process of my article, “Delayed Vulvar Metastases from Rectal Carcinoma: A Case Report.” I greatly appreciate the assistance and guidance I received from your team, which made the entire process smooth and efficient. The peer review process was thorough and constructive, contributing to the overall quality of the final article. I am very grateful for the high level of professionalism and commitment shown by the editorial staff, and I look forward to maintaining a long-term collaboration with the International Journal of Clinical Case Reports and Reviews.
Dear Agrippa Hilda- Editorial Coordinator of Journal of Neuroscience and Neurological Surgery, "The peer review process was very quick and of high quality, which can also be seen in the articles in the journal. The collaboration with the editorial office was very good."
I would like to offer my testimony in the support. I have received through the peer review process and support the editorial office where they are to support young authors like me, encourage them to publish their work in your esteemed journals, and globalize and share knowledge globally. I really appreciate your journal, peer review, and editorial office.
My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.
My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.
My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.
Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner
Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”
Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.
Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.
The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.
Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.
Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.
Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.
“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.
Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.
I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.
I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.
I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.
We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.
I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.
"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".
I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!
Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.
Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.
International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.
Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.
As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.
Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.
This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.
Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.
Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.
Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.
Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.
Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.
The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.
We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.
Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.
Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.
Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.
Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.