Research Article | DOI: https://doi.org/10.31579/2690-8808/271
1 Laboratory for Basic Biology of Stem Cells (LABCET), Instituto Carlos Chagas - FIOCRUZ-PR, Curitiba, Paraná, 81830-010, Brazil.
2 Core for Cell Technology, School of Medicine and Life Sciences - Pontifícia Universidade Católica do Paraná, Curitiba, Paraná, Brazil.
3 Department of Pediatrics, Complexo Hospital de Clínicas, Universidade Federal do Paraná, Curitiba, Paraná, Brazil.
4 Pulmonology Division, Federal University of Paraná, Curitiba, Paraná, Brazil.
*Corresponding Author: Patrícia Shigunov, Laboratory for Basic Biology of Stem Cells (LABCET), Instituto Carlos Chagas - FIOCRUZ-PR, Curitiba, Paraná, 81830-010, Brazil.
Citation: Evelin Brandão DS, Fabiane Barchiki, Jhonatan B. Lino, Letícia W. Bassai, Kuniyoshi Rebelatto CL, (2025), Distinct Osteogenic Differentiation Patterns in Dental Pulp Stromal Cells from Cystic Fibrosis Patients, J, Clinical Case Reports and Studies, 6(7); DOI:10.31579/2690-8808/271
Copyright: ©, 2025, Patrícia Shigunov. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Received: 26 August 2025 | Accepted: 05 September 2025 | Published: 11 September 2025
Keywords: cystic fibrosis; dental pulp stromal cells; osteogenesis; gene mutations; cell characterization
Background: Cystic fibrosis (CF) is a genetic disease caused by mutations in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. It affects multiple organs, and some patients develop bone-related issues, such as osteopenia and osteoporosis.
Methods: DPSCs were characterized by immunophenotyping for mesenchymal stromal cell (MSC) markers. Proliferative capacity was assessed by Ki67 immunofluorescence. Osteogenic differentiation was induced to evaluate the mineralized matrix and the expression of genes including CFTR, RUNX2, and OPG by qPCR.
Results: Here, we describe the osteogenic differentiation of dental pulp stromal cells (DPSCs) derived from two CF patients carrying distinct genotypes: one with homozygous F508del and another with compound heterozygous F508del/R347H. DPSCs were characterized by mesenchymal stromal cell markers and showed no differences in immunophenotype or proliferative capacity compared to healthy donors. However, osteogenic differentiation outcomes varied according to genotype. DPSCs from the F508del/F508del patient exhibited enhanced mineralized matrix formation and increased RUNX2 expression, while DPSCs from the F508del/R347H patient displayed reduced osteogenesis with RUNX2 levels comparable to healthy cells. In both CF patients, osteoprotegerin (OPG) expression decreased after osteogenic induction, in contrast to the increase observed in healthy donors.
Conclusion: These findings demonstrate genotype-specific differences in the osteogenic behavior of DPSCs from CF patients, highlighting a potential contribution of CFTR mutations to bone fragility and underscoring the importance of considering molecular variability in CF-associated bone disease.
Dental pulp is a rich source of adult stromal cells, known as dental pulp stromal cells (DPSCs), which have shown promise in various regenerative medicine applications [1]. These cells have been extensively characterized by their properties such as multipotency and self-renewal [2], [3]. However, the behavior of DPSCs in individuals with chronic diseases, particularly cystic fibrosis (CF), remains largely unknown. CF is a life-threatening genetic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene [4], which leads to defective chloride ion transport and results in the accumulation of thick, sticky mucus in the respiratory and digestive tracts [5]. The disease affects multiple organs, including the lung, pancreas, and liver, and patients with CF also suffer from a range of bone problems, such as osteopenia and osteoporosis [6]. This study aimed to assess whether DPSCs from cystic fibrosis patients preserve their proliferative capacity and to determine how CFTR mutations influence their osteogenic differentiation potential.

2.1 Case Report Description
Dental pulp stem cells (DPSCs) were obtained from four pediatric donors. The first donor CFTR(WT-1), a five-year-old boy, had no CFTR mutations, and the cells were isolated from a primary tooth. The second donor CFTR(WT-2), a girl, also carried no CFTR mutations, and DPSCs were collected from a primary tooth; however, clinical information such as age, weight, and height was not available. The third donor CFTR(F508del+R347H), a four-year-old girl, carried compound heterozygous mutations in the CFTR gene: F508del (deletion of phenylalanine at position 508) and R347H (arginine to histidine substitution at position 347). DPSCs were derived from primary tooth. The fourth donor CFTR(F508del+F508del), a two-year-old girl, carried the homozygous F508del / F508del mutation, and DPSCs were also isolated from a primary tooth. DPSCs derived from primary teeth are widely used as a source of mesenchymal stromal cells [7], [8], [9]10].
2.2 Study settings and ethical considerations
This study was approved by the Ethics Committee of Fundação Oswaldo Cruz, Brazil (CAAE: 80641317.1.0000.5248), Hospital de Clínicas da Universidade Federal do Paraná (CAAE: 80641317.1.3003.0096), and Pontifícia Universidade Católica do Paraná - PUCPR (CAAE: 80641317.1.3001.0020). Written informed consent was obtained from all guardians or donors prior to sample collection, and all procedures were carried out in compliance with the guidelines set forth by the respective ethics committees. To ensure the privacy and confidentiality of the donors, all samples were coded and handled in accordance with the relevant ethical and legal regulations.
2.3 Tooth pulp collection, isolation and maintenance
To isolate DPSCs, teeth were washed in phosphate-buffered saline solution (PBS) and the tooth pulp fragments were mechanically removed with a K file, as previously described by Fracaro et al., (2020). The pulp tissue was then dissociated using collagenase type II and centrifuged in PBS. The resulting cells were resuspended and plated in flasks with Iscove's Modified Dulbecco's Media IMDM supplemented with 1% antibiotic penicillin/streptomycin/amphotericin B, 8 µg/mL vancomycin and 15
Isolating stromal cells from patients with CF presents several challenges, including the difficulty of obtaining viable cells from a rare sample and the presence of antibiotic-resistant microbiota, which leads to recurrent contamination in cell culture. Despite these obstacles, we successfully isolated stromal cells from the tooth pulp of two patients with CF, each with a specific genotype, and two health donors. Donors´ information, including confirmation of the R347H mutation and F508del mutation are shown in Figure 1. Immunophenotyping of DPSCs from healthy and cystic fibrosis donors present expression of mesenchymal stem cell markers CD90, CD105, CD73, and CD140b, and absence of negative markers CD34, CD11b, CD45, CD19, CD31, and HLA-DR (Figure 2 and Supplementary Figure S1, S2 and table S1). The effect of CFTR gene mutations on the proliferative activity of DPSCs, was analyzed by the rate at which cells divide and replicate using a Ki67 proliferation assay. DPSCs were plated at 40% and 90% confluence, and the expression of Ki67 was assessed using immunofluorescence. Images were captured using high-content imaging (Figure 3A), and the percentage of Ki67-positive cells was compared between cystic fibrosis and healthy donors (Figure 3B). Our results revealed no significant difference in the proliferative activity of DPSCs between cystic fibrosis and healthy donors, suggesting that CFTR mutations do not impact the proliferation of DPSCs.

Table S1: Analysis of marker expression in MSCs. Values referring to the percentage of positive cells after analysis using flow cytometry for positive and negative markers for MSCs.

Figure S1:Analysis of DPSCs marker expression. Representative flow cytometry histograms showing positive markers for MSCs. The pink line represents the isotypic control, and the colors represent different donors: Green for CFTR(WT-1), Blue for CFTR(WT-2), Black for CFTR(F508del+R347H), and Purple for CFTR(F508del+F508del).

Figure S2:Analysis of DPSCs marker expression. Representative flow cytometry histograms showing negative markers for MSCs. The pink line represents the isotypic control, and the colors represent different donors: Green for CFTR(WT-1), Blue for CFTR(WT-2), Black for CFTR(F508del+R347H), and Purple for CFTR(F508del+F508del).
We hypothesized that CFTR gene mutations could affect osteogenesis in CF patients. To test this hypothesis, we induced osteogenic differentiation of DPSCs from healthy and cystic fibrosis donors and quantified the area of differentiation using the Osteoimage Mineralization Assay, which stains the mineralized matrix (Alexa 488) (Figure 4A). The quantification of osteogenic differentiation was evaluated using the positive area for Alexa 488 (Green) through high-content imaging (Figure 4B). Our results revealed that DPSCs with homozygous F508del mutations had a significantly higher ability to differentiate compared to cells with heterozygous F508del and R347H mutations. Conversely, cells with heterozygous mutations showed a reduction in osteogenic differentiation compared to cells with homozygous mutations and healthy (Figure 4B). These findings suggest that the osteogenic capacity of DPSCs may vary depending on the types of mutations present in the CFTR gene. However, further studies are needed to confirm these results and explore the potential mechanisms underlying these findings.

Figure 1: Donor profiles and CFTR mutation status. (A) Donor characteristics. Abbreviations: CFTR, cystic fibrosis transmembrane conductance regulator; WT, wild type; F, female; M, male; BMI, body mass index; n.i., not informed. (B) Sanger sequencing electropherograms of CFTR PCR products from wild-type (WT) and cystic fibrosis (CF) donors confirm the presence of the F508del deletion and the R347H substitution. The WT sample displays the expected CFTR sequence (blue), whereas the CF samples exhibit the respective mutations highlighted in red.

Figure 2: Analysis of DPSC marker expression. (A) Percentage of cells expressing positive mesenchymal markers. Each marker is shown on the X-axis, and donors are categorized as wild type CFTR (WT-1, WT-2) or cystic fibrosis CFTR (F508del/F508del, F508del/R347H). (B) Percentage of cells expressing negative markers. Each marker is shown on the X-axis, with the same donor categorization as in (A).
| Official Symbol | NCBI ID | Primer sequence (5’-3’) | Amplicon (bp) |
| CFTR_RNA | NM_000492 | Forward: 5’ - ATGGGAGAACTGGAGCCTTC - 3’ Reverse: 5’ - CACCGAATGGTGCAGGCATACC - 3’ | 92 |
| CFTR_DNA__F508del | NC_000007.14 | Forward: 5’ - ATGGGAGAACTGGAGCCTTC - 3’ Reverse: 5’ - AGTTTCTTACCTTCTCTAGTTG - 3’ | 180 |
| CFTR_DNA__ R347H | NC_000007.14 | Forward: 5’ - TATTTGAAAAATAAAATAAC - 3’ Reverse: 5’ - GTATTAGCTGGCAACTTTTA - 3’ | 443 |
| OPG | NM_002546.4 | Forward: 5’ - GCTCACAAAGCACAGCATTTCCAG - 3’ Reverse: 5’ - CTGTTTTCTACAGAGGCAAATATTTCT - 3’ | 106 |
| POLR2A | NM_078569.3 | Forward: 5’ - TACACGTCATCCTCTTTGATGGCT - 3’ Reverse: 5’ - GTGCGGCTGCTTCCATAA - 3’ | 186 |
| RUNX2 | NM_001015051.4 | Forward: 5’ - ACTGGCGCTGCAACAAGAAC - 3’ Reverse: 5’ - CCCGGCATGACAGTAACCA - 3’ | 91 |
Table 1: Primer sets used for RT-qPCR analysis of gene expression. The primer sets were designed for CFTR (CF transmembrane conductance regulator), OPG (NF receptor superfamily member 11b), POLR2A (RNA polymerase II subunit A), and RUNX2 (RUNX family transcription factor 2) genes.


Figure 3: Proliferation analysis of DPSCs. (A) Immunofluorescence labeling of Ki67 in the nuclei of cells in the proliferative phase. Cells were plated at 40% and 90% confluence. Nuclei were stained with DAPI (blue) and Ki67 was detected with an anti-Ki67 antibody (green). Images were acquired using the Operetta system. Scale bar: 100 µm. (B) Quantification of Ki67-positive cells. Experimental replicates at 40% confluence are shown in orange and at 90% confluence in blue. Each donor is represented individually on the X-axis, with the percentage of Ki67-positive cells on the Y-axis. Statistical analysis: two-way ANOVA, ***p < 0.001.


Figure 4:Osteogenic differentiation of DPSCs. (A) Representative images of cells induced for osteogenesis (Induced) and non-induced cells (Control) for 28 days. Mineralized matrix was stained with OsteoImage™ (green, Alexa 488), and nuclei were stained with DAPI (blue). Images acquired with Operetta. Scale bar: 500 µm. (B) Quantification of osteogenic differentiation based on the OsteoImage™-positive area (OI+, µm²). Induced samples are shown in red, and controls in purple. Statistical analysis: two-way ANOVA, **p < 0.01, ****p < 0.001.
The genes RUNX2 and OPG (also known as tumor necrosis factor receptor superfamily member 11b, TNFRSF11B) are key regulators of osteogenesis, where a tightly controlled balance is essential for maintaining bone tissue integrity. To investigate the molecular basis of the genotype-dependent differences observed in mineralized matrix formation, we performed quantitative PCR to assess the expression of CFTR, RUNX2, and OPG (Figure 5). CFTR expression remained unchanged after seven days of osteogenic induction. RUNX2 expression in DPSCs heterozygous for the F508del mutation was comparable to that of healthy cells, whereas DPSCs from homozygous F508del donors showed elevated RUNX2 levels. In parallel, OPG expression increased in healthy donors but decreased in CF donors after seven days of osteogenic induction, highlighting genotype-specific regulation of osteogenic pathways.

Figure 5: Gene expression of CFTR (A), RUNX2 (B) and OPG (C) in DPSCs. Evaluation of CFTR, RUNX2 and OPG gene expression in DPSCs from healthy donors and CF carriers, induced to osteogenic differentiation for 7 days. Samples normalized with POLR2A. OPG (osteoprogerin), CFTR (cystic fibrosis transmembrane conductance regulator), RUNX2 (Runt-related transcription factor 2), ns (no significative).
CD73, CD90 and CD105 in ≥ 95% of the population, along with the absence (≤ 2% positive) of CD11b, CD19, CD34, CD45, and HLA-DR, [11].. Similarly, the DPSCs population maintained a consistent percentage of positive and negative markers [8]. However, due to the limited number of biological replicates in our study, we were unable to statistically determine whether the observed deviation from the expected marker percentages is significant. Further studies with a larger number of biological replicates are needed to elucidate this aspect.
Cystic fibrosis is a genetic disorder that affects many systems in the body, including the respiratory and digestive systems [14]. While CFTR expression has been shown to influence epithelial proliferation in lung development [15], the effects on proliferation seem to vary depending on the cell type and developmental stage. For instance, studies have demonstrated increased proliferation of intestinal stem cells and activation of the Wnt/β-catenin signaling pathway in the CF [16], while defective CFTR has been linked to inhibited endothelial cell proliferation and altered gene signatures related to migration and proliferation [17]. However, in our study, no differences in the proliferative activity of DPSCs from CF patients were detected. These findings suggest that the impact of CFTR mutations on proliferation is context-dependent, and further investigations are needed to fully understand the mechanisms involved.
Cystic fibrosis can also lead to osteoporosis and osteopenia [14]. These conditions are characterized by reduced bone density and increased risk of fractures [18], [19], and altered bone metabolism, including impaired turnover [20]. The imbalance between osteogenesis (formation of new bone) and osteoclastogenesis (resorption of existing bone) may contribute to the onset of these bone disorders. Osteoclastogenesis is a process by which bone-resorbing cells, called osteoclasts, are formed and mature. In healthy individuals, the balance between osteoclastogenesis and osteogenesis is carefully regulated to maintain bone homeostasis. However, in individuals with cystic fibrosis, this balance can be disrupted, leading to a reduction in bone density, but the exact mechanism is not well understood. Mice carrying the F508del CFTR mutation demonstrate reduced osteoblast differentiation and function, as reported by Le Henaff et al., (2015). These effects are associated with increased NF-κB activity and decreased Wnt/β-catenin signaling. In this study, we observed that the osteogenic capacity of DPSCs can vary depending on the specific mutations present in the CFTR gene. DPSCs with homozygous mutations in the CFTR gene (F508del) demonstrated enhanced osteogenic capacity, whereas DPSCs with heterozygous mutations (F508del and R347H) exhibited reduced osteogenic capacity compared to healthy DPSCs. The functional impact of CFTR mutations, such as the βV348M mutation for example, may play a significant role in the pathophysiology of CF by dysregulating sodium and fluid absorption in the respiratory tract [22]. Furthermore, the combined effects of two mutations in cis can have a profound impact on CFTR function, contributing to the extensive phenotypic variability observed in CF. For instance, the coexistence of R347H and D979A mutations leads to a synergistic impairment of Cl (-) current, resulting in a significant decrease in CFTR function [23]. Certain genetic mutations can have a significant impact on the proper folding of a protein, leading to alterations in its three-dimensional structure or in post-translational modification sites crucial for protein function. These structural changes can affect protein stability, the ability to interact with other molecules, or even modify its enzymatic activity. Additionally, mutations may result in the exposure of new domains in the protein, allowing interactions with other signaling pathways that would not normally occur. These additional interactions can trigger altered signaling cascades, affecting various cellular processes such as proliferation, differentiation, and cell survival. Therefore, it is important to recognize that protein mutations can have effects beyond their direct function, potentially influencing the interaction with other signaling pathways and contributing to the complexity of genetic diseases.
The expression of osteogenesis markers, such as RUNX2 and OPG, undergoes modulation during the 7-day osteogenic differentiation period. Notably, at the early stages of osteogenesis, DPSCs homozygous for the F508del mutation exhibit higher expression levels of RUNX2 compared to other induced DPSCs. Robert et al., (2018) reported that RUNX2 was not detected in MSCs committed to osteoblast lineage after 24 hours of osteogenic induction. Furthermore, other studies have indicated that the expression of RUNX2 becomes evident at later stages of osteogenic differentiation [25]. Specifically, RUNX2 type I has been associated with early osteoblastogenesis, while RUNX2 type II is necessary for the terminal stages of osteoblastic maturation [26], [27]. In this study, the oligonucleotides used to detect RUNX2 expression can recognize all isoforms of RUNX2 mRNA, providing a general overview of gene expression. However, it should be noted that this approach cannot distinguish the specific isoform expressed at each stage. Interestingly, the expression of OPG shows an inverse relationship with RUNX2 expression. OPG is a member of the TNF receptor superfamily that acts as a dose-dependent inhibitor of osteoclast differentiation from precursor cells [28] corroborating these findings, Le Henaff et al. (2015) demonstrated a significant reduction in the mRNA level of OPG in osteoblasts derived from F508del-CFTR mice compared to osteoblasts from WT mice. In individuals homozygous for the F508del mutation in the CFTR gene, there appears to be an impact on osteogenesis, promoting osteoblast formation. Consequently, at a systemic level and over the long term, the imbalance between osteoclastogenesis and osteogenesis resulting from altered OPG expression by DPSCs could contribute to the development of osteoporosis and osteopenia in cystic fibrosis. These findings suggest that DPSCs from CF donors display distinct gene expression patterns related to osteogenesis compared to DPSCs from healthy donors and those with different genotypes. Further research is needed to fully understand the underlying mechanisms and to develop effective treatments for the bone complications associated with CF.
An important limitation of this study is the reduced number of donors included in each cystic fibrosis variant group. This limitation arises from the inherent difficulty in obtaining biological samples from patients with specific genotypes, since the frequency of certain mutations in the population is relatively low. In addition, the process of sample collection and cell isolation depends on donor availability and sample viability, which further restricts the final sample size. Nevertheless, the data obtained are consistent and allow the observation of relevant trends, although they should be interpreted with caution and validated in future studies with larger cohorts.
DPSCs from CF patients were successfully established and exhibited normal immunophenotype and proliferation, but their osteogenic potential varied according to CFTR genotype. Distinct RUNX2 and OPG expression profiles highlight genotype-specific modulation of osteogenesis, underscoring a potential role for CFTR mutations in CF-associated bone fragility.
The authors would like to acknowledge the Program for Technological Development in Tools for Health-PDTIS FIOCRUZ for use of its facilities.
Competing interests
The authors report that there are no potential conflicts of interest or financial interests.
Funding
This work was supported by FIOCRUZ (Inova VPPCB-008-FIO-18) and National Council for Scientific and Technological Development – CNPq (Proep 442324/2019-7). PS received grant from the National Council for Scientific and Technological Development (CNPq – Grant Holder PQ 303742/2022-4).
Authors' contributions
EBS carried out cellular and molecular studies. FB and CLKR carried out DPSC isolation. JBL and LB carried out cell culture. CAR, MM, and NRF carried out patient recruitment. RGJ performed qPCR tests. PS carried out the cytometry experiments. EBS and PS drafted the manuscript. All authors read and approved the final manuscript.
Declaration of generative AI and AI-assisted technologies in the writing process
During the preparation of this work the author(s) used ChatGPT to improve the clarity and understanding of the text. After using this tool/service, the author(s) reviewed and edited the content as needed and take(s) full responsibility for the content of the publication.
Dear Editorial Team, Clinical Medical Reviews and Reports. My experience with the journal was highly positive. The peer-review process was rigorous, constructive, and completed in a timely manner. The reviewers provided valuable comments that helped improve the quality and clarity of our manuscript. The editorial office was professional, responsive, and supportive throughout all stages of the publication process. Communication was clear and efficient, and any questions were addressed promptly. Overall, I found the journal to maintain high scientific standards and an excellent publication workflow. I would be pleased to consider submitting future work to this journal. Best wishes from, Elena Popa.
It was my pleasure to submit my testimonial concerning the Reviewer Board of our Scientific Journal “Brain and Neurological Disorders”. The Reviewers focused on some modifications and their contribution was helpful. The ladies of our Editorial Office were also supported my efforts. It was my honor to have such a co-operation and I am looking forward for more collaboration.
Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Thank you for the speedy and efficient peer review process. I appreciate the fact that your peer reviewers do not take months to respond like with some other journals. I would also like to thank the editorial office for responding quickly to my questions. It is an excellent journal. I plan to submit more manuscripts in the future. Best wishes from, Robert W. McGee
Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Working with you and your team on our recent publication in JCRR has been a truly wonderful and enjoyable experience. The responses were prompt, and the reviewers were patient, constructive, and highly professional. One reviewer in particular gave me the feeling that a professor was carefully reading and commenting on my coursework, which was deeply touching. The entire process was straightforward and hassle‑free, with no tedious online forms to complete. I highly recommend this journal. Best wishes from, DR Aibing Rao, Head of R&D
I Appreciate the Opportunity to Share my Experience with the Journal of Clinical Research and Reports. The peer review process was timely and constructive, and the feedback provided helped improve the quality of our manuscript. The editorial office was professional, responsive, and supportive throughout the process, ensuring smooth communication and efficient handling of the submission. Overall, it was a positive experience collaborating with your team.
Dear Mercy Grace, Editorial Coordinator of Obstetrics Gynecology and Reproductive Sciences, We would like to express our gratitude for your help at all stages of publishing and editing the article. The editors of the magazine answer all the necessary questions and help at every stage. We will definitely continue to cooperate and publish other works in the Obstetrics Gynecology and Reproductive Sciences! Best wishes from, Alla Konstantinovna Politova,