AUCTORES
Globalize your Research
Research Article | DOI: https://doi.org/10.31579/2690-8808/271
1 Laboratory for Basic Biology of Stem Cells (LABCET), Instituto Carlos Chagas - FIOCRUZ-PR, Curitiba, Paraná, 81830-010, Brazil.
2 Core for Cell Technology, School of Medicine and Life Sciences - Pontifícia Universidade Católica do Paraná, Curitiba, Paraná, Brazil.
3 Department of Pediatrics, Complexo Hospital de Clínicas, Universidade Federal do Paraná, Curitiba, Paraná, Brazil.
4 Pulmonology Division, Federal University of Paraná, Curitiba, Paraná, Brazil.
*Corresponding Author: Patrícia Shigunov, Laboratory for Basic Biology of Stem Cells (LABCET), Instituto Carlos Chagas - FIOCRUZ-PR, Curitiba, Paraná, 81830-010, Brazil.
Citation: Evelin Brandão DS, Fabiane Barchiki, Jhonatan B. Lino, Letícia W. Bassai, Kuniyoshi Rebelatto CL, (2025), Distinct Osteogenic Differentiation Patterns in Dental Pulp Stromal Cells from Cystic Fibrosis Patients, J, Clinical Case Reports and Studies, 6(7); DOI:10.31579/2690-8808/271
Copyright: ©, 2025, Patrícia Shigunov. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Received: 26 August 2025 | Accepted: 05 September 2025 | Published: 11 September 2025
Keywords: cystic fibrosis; dental pulp stromal cells; osteogenesis; gene mutations; cell characterization
Background: Cystic fibrosis (CF) is a genetic disease caused by mutations in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. It affects multiple organs, and some patients develop bone-related issues, such as osteopenia and osteoporosis.
Methods: DPSCs were characterized by immunophenotyping for mesenchymal stromal cell (MSC) markers. Proliferative capacity was assessed by Ki67 immunofluorescence. Osteogenic differentiation was induced to evaluate the mineralized matrix and the expression of genes including CFTR, RUNX2, and OPG by qPCR.
Results: Here, we describe the osteogenic differentiation of dental pulp stromal cells (DPSCs) derived from two CF patients carrying distinct genotypes: one with homozygous F508del and another with compound heterozygous F508del/R347H. DPSCs were characterized by mesenchymal stromal cell markers and showed no differences in immunophenotype or proliferative capacity compared to healthy donors. However, osteogenic differentiation outcomes varied according to genotype. DPSCs from the F508del/F508del patient exhibited enhanced mineralized matrix formation and increased RUNX2 expression, while DPSCs from the F508del/R347H patient displayed reduced osteogenesis with RUNX2 levels comparable to healthy cells. In both CF patients, osteoprotegerin (OPG) expression decreased after osteogenic induction, in contrast to the increase observed in healthy donors.
Conclusion: These findings demonstrate genotype-specific differences in the osteogenic behavior of DPSCs from CF patients, highlighting a potential contribution of CFTR mutations to bone fragility and underscoring the importance of considering molecular variability in CF-associated bone disease.
Dental pulp is a rich source of adult stromal cells, known as dental pulp stromal cells (DPSCs), which have shown promise in various regenerative medicine applications [1]. These cells have been extensively characterized by their properties such as multipotency and self-renewal [2], [3]. However, the behavior of DPSCs in individuals with chronic diseases, particularly cystic fibrosis (CF), remains largely unknown. CF is a life-threatening genetic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene [4], which leads to defective chloride ion transport and results in the accumulation of thick, sticky mucus in the respiratory and digestive tracts [5]. The disease affects multiple organs, including the lung, pancreas, and liver, and patients with CF also suffer from a range of bone problems, such as osteopenia and osteoporosis [6]. This study aimed to assess whether DPSCs from cystic fibrosis patients preserve their proliferative capacity and to determine how CFTR mutations influence their osteogenic differentiation potential.

2.1 Case Report Description
Dental pulp stem cells (DPSCs) were obtained from four pediatric donors. The first donor CFTR(WT-1), a five-year-old boy, had no CFTR mutations, and the cells were isolated from a primary tooth. The second donor CFTR(WT-2), a girl, also carried no CFTR mutations, and DPSCs were collected from a primary tooth; however, clinical information such as age, weight, and height was not available. The third donor CFTR(F508del+R347H), a four-year-old girl, carried compound heterozygous mutations in the CFTR gene: F508del (deletion of phenylalanine at position 508) and R347H (arginine to histidine substitution at position 347). DPSCs were derived from primary tooth. The fourth donor CFTR(F508del+F508del), a two-year-old girl, carried the homozygous F508del / F508del mutation, and DPSCs were also isolated from a primary tooth. DPSCs derived from primary teeth are widely used as a source of mesenchymal stromal cells [7], [8], [9]10].
2.2 Study settings and ethical considerations
This study was approved by the Ethics Committee of Fundação Oswaldo Cruz, Brazil (CAAE: 80641317.1.0000.5248), Hospital de Clínicas da Universidade Federal do Paraná (CAAE: 80641317.1.3003.0096), and Pontifícia Universidade Católica do Paraná - PUCPR (CAAE: 80641317.1.3001.0020). Written informed consent was obtained from all guardians or donors prior to sample collection, and all procedures were carried out in compliance with the guidelines set forth by the respective ethics committees. To ensure the privacy and confidentiality of the donors, all samples were coded and handled in accordance with the relevant ethical and legal regulations.
2.3 Tooth pulp collection, isolation and maintenance
To isolate DPSCs, teeth were washed in phosphate-buffered saline solution (PBS) and the tooth pulp fragments were mechanically removed with a K file, as previously described by Fracaro et al., (2020). The pulp tissue was then dissociated using collagenase type II and centrifuged in PBS. The resulting cells were resuspended and plated in flasks with Iscove's Modified Dulbecco's Media IMDM supplemented with 1% antibiotic penicillin/streptomycin/amphotericin B, 8 µg/mL vancomycin and 15
Isolating stromal cells from patients with CF presents several challenges, including the difficulty of obtaining viable cells from a rare sample and the presence of antibiotic-resistant microbiota, which leads to recurrent contamination in cell culture. Despite these obstacles, we successfully isolated stromal cells from the tooth pulp of two patients with CF, each with a specific genotype, and two health donors. Donors´ information, including confirmation of the R347H mutation and F508del mutation are shown in Figure 1. Immunophenotyping of DPSCs from healthy and cystic fibrosis donors present expression of mesenchymal stem cell markers CD90, CD105, CD73, and CD140b, and absence of negative markers CD34, CD11b, CD45, CD19, CD31, and HLA-DR (Figure 2 and Supplementary Figure S1, S2 and table S1). The effect of CFTR gene mutations on the proliferative activity of DPSCs, was analyzed by the rate at which cells divide and replicate using a Ki67 proliferation assay. DPSCs were plated at 40% and 90% confluence, and the expression of Ki67 was assessed using immunofluorescence. Images were captured using high-content imaging (Figure 3A), and the percentage of Ki67-positive cells was compared between cystic fibrosis and healthy donors (Figure 3B). Our results revealed no significant difference in the proliferative activity of DPSCs between cystic fibrosis and healthy donors, suggesting that CFTR mutations do not impact the proliferation of DPSCs.

Table S1: Analysis of marker expression in MSCs. Values referring to the percentage of positive cells after analysis using flow cytometry for positive and negative markers for MSCs.

Figure S1:Analysis of DPSCs marker expression. Representative flow cytometry histograms showing positive markers for MSCs. The pink line represents the isotypic control, and the colors represent different donors: Green for CFTR(WT-1), Blue for CFTR(WT-2), Black for CFTR(F508del+R347H), and Purple for CFTR(F508del+F508del).

Figure S2:Analysis of DPSCs marker expression. Representative flow cytometry histograms showing negative markers for MSCs. The pink line represents the isotypic control, and the colors represent different donors: Green for CFTR(WT-1), Blue for CFTR(WT-2), Black for CFTR(F508del+R347H), and Purple for CFTR(F508del+F508del).
We hypothesized that CFTR gene mutations could affect osteogenesis in CF patients. To test this hypothesis, we induced osteogenic differentiation of DPSCs from healthy and cystic fibrosis donors and quantified the area of differentiation using the Osteoimage Mineralization Assay, which stains the mineralized matrix (Alexa 488) (Figure 4A). The quantification of osteogenic differentiation was evaluated using the positive area for Alexa 488 (Green) through high-content imaging (Figure 4B). Our results revealed that DPSCs with homozygous F508del mutations had a significantly higher ability to differentiate compared to cells with heterozygous F508del and R347H mutations. Conversely, cells with heterozygous mutations showed a reduction in osteogenic differentiation compared to cells with homozygous mutations and healthy (Figure 4B). These findings suggest that the osteogenic capacity of DPSCs may vary depending on the types of mutations present in the CFTR gene. However, further studies are needed to confirm these results and explore the potential mechanisms underlying these findings.

Figure 1: Donor profiles and CFTR mutation status. (A) Donor characteristics. Abbreviations: CFTR, cystic fibrosis transmembrane conductance regulator; WT, wild type; F, female; M, male; BMI, body mass index; n.i., not informed. (B) Sanger sequencing electropherograms of CFTR PCR products from wild-type (WT) and cystic fibrosis (CF) donors confirm the presence of the F508del deletion and the R347H substitution. The WT sample displays the expected CFTR sequence (blue), whereas the CF samples exhibit the respective mutations highlighted in red.

Figure 2: Analysis of DPSC marker expression. (A) Percentage of cells expressing positive mesenchymal markers. Each marker is shown on the X-axis, and donors are categorized as wild type CFTR (WT-1, WT-2) or cystic fibrosis CFTR (F508del/F508del, F508del/R347H). (B) Percentage of cells expressing negative markers. Each marker is shown on the X-axis, with the same donor categorization as in (A).
| Official Symbol | NCBI ID | Primer sequence (5’-3’) | Amplicon (bp) |
| CFTR_RNA | NM_000492 | Forward: 5’ - ATGGGAGAACTGGAGCCTTC - 3’ Reverse: 5’ - CACCGAATGGTGCAGGCATACC - 3’ | 92 |
| CFTR_DNA__F508del | NC_000007.14 | Forward: 5’ - ATGGGAGAACTGGAGCCTTC - 3’ Reverse: 5’ - AGTTTCTTACCTTCTCTAGTTG - 3’ | 180 |
| CFTR_DNA__ R347H | NC_000007.14 | Forward: 5’ - TATTTGAAAAATAAAATAAC - 3’ Reverse: 5’ - GTATTAGCTGGCAACTTTTA - 3’ | 443 |
| OPG | NM_002546.4 | Forward: 5’ - GCTCACAAAGCACAGCATTTCCAG - 3’ Reverse: 5’ - CTGTTTTCTACAGAGGCAAATATTTCT - 3’ | 106 |
| POLR2A | NM_078569.3 | Forward: 5’ - TACACGTCATCCTCTTTGATGGCT - 3’ Reverse: 5’ - GTGCGGCTGCTTCCATAA - 3’ | 186 |
| RUNX2 | NM_001015051.4 | Forward: 5’ - ACTGGCGCTGCAACAAGAAC - 3’ Reverse: 5’ - CCCGGCATGACAGTAACCA - 3’ | 91 |
Table 1: Primer sets used for RT-qPCR analysis of gene expression. The primer sets were designed for CFTR (CF transmembrane conductance regulator), OPG (NF receptor superfamily member 11b), POLR2A (RNA polymerase II subunit A), and RUNX2 (RUNX family transcription factor 2) genes.


Figure 3: Proliferation analysis of DPSCs. (A) Immunofluorescence labeling of Ki67 in the nuclei of cells in the proliferative phase. Cells were plated at 40% and 90% confluence. Nuclei were stained with DAPI (blue) and Ki67 was detected with an anti-Ki67 antibody (green). Images were acquired using the Operetta system. Scale bar: 100 µm. (B) Quantification of Ki67-positive cells. Experimental replicates at 40% confluence are shown in orange and at 90% confluence in blue. Each donor is represented individually on the X-axis, with the percentage of Ki67-positive cells on the Y-axis. Statistical analysis: two-way ANOVA, ***p < 0.001.


Figure 4:Osteogenic differentiation of DPSCs. (A) Representative images of cells induced for osteogenesis (Induced) and non-induced cells (Control) for 28 days. Mineralized matrix was stained with OsteoImage™ (green, Alexa 488), and nuclei were stained with DAPI (blue). Images acquired with Operetta. Scale bar: 500 µm. (B) Quantification of osteogenic differentiation based on the OsteoImage™-positive area (OI+, µm²). Induced samples are shown in red, and controls in purple. Statistical analysis: two-way ANOVA, **p < 0.01, ****p < 0.001.
The genes RUNX2 and OPG (also known as tumor necrosis factor receptor superfamily member 11b, TNFRSF11B) are key regulators of osteogenesis, where a tightly controlled balance is essential for maintaining bone tissue integrity. To investigate the molecular basis of the genotype-dependent differences observed in mineralized matrix formation, we performed quantitative PCR to assess the expression of CFTR, RUNX2, and OPG (Figure 5). CFTR expression remained unchanged after seven days of osteogenic induction. RUNX2 expression in DPSCs heterozygous for the F508del mutation was comparable to that of healthy cells, whereas DPSCs from homozygous F508del donors showed elevated RUNX2 levels. In parallel, OPG expression increased in healthy donors but decreased in CF donors after seven days of osteogenic induction, highlighting genotype-specific regulation of osteogenic pathways.

Figure 5: Gene expression of CFTR (A), RUNX2 (B) and OPG (C) in DPSCs. Evaluation of CFTR, RUNX2 and OPG gene expression in DPSCs from healthy donors and CF carriers, induced to osteogenic differentiation for 7 days. Samples normalized with POLR2A. OPG (osteoprogerin), CFTR (cystic fibrosis transmembrane conductance regulator), RUNX2 (Runt-related transcription factor 2), ns (no significative).
CD73, CD90 and CD105 in ≥ 95% of the population, along with the absence (≤ 2% positive) of CD11b, CD19, CD34, CD45, and HLA-DR, [11].. Similarly, the DPSCs population maintained a consistent percentage of positive and negative markers [8]. However, due to the limited number of biological replicates in our study, we were unable to statistically determine whether the observed deviation from the expected marker percentages is significant. Further studies with a larger number of biological replicates are needed to elucidate this aspect.
Cystic fibrosis is a genetic disorder that affects many systems in the body, including the respiratory and digestive systems [14]. While CFTR expression has been shown to influence epithelial proliferation in lung development [15], the effects on proliferation seem to vary depending on the cell type and developmental stage. For instance, studies have demonstrated increased proliferation of intestinal stem cells and activation of the Wnt/β-catenin signaling pathway in the CF [16], while defective CFTR has been linked to inhibited endothelial cell proliferation and altered gene signatures related to migration and proliferation [17]. However, in our study, no differences in the proliferative activity of DPSCs from CF patients were detected. These findings suggest that the impact of CFTR mutations on proliferation is context-dependent, and further investigations are needed to fully understand the mechanisms involved.
Cystic fibrosis can also lead to osteoporosis and osteopenia [14]. These conditions are characterized by reduced bone density and increased risk of fractures [18], [19], and altered bone metabolism, including impaired turnover [20]. The imbalance between osteogenesis (formation of new bone) and osteoclastogenesis (resorption of existing bone) may contribute to the onset of these bone disorders. Osteoclastogenesis is a process by which bone-resorbing cells, called osteoclasts, are formed and mature. In healthy individuals, the balance between osteoclastogenesis and osteogenesis is carefully regulated to maintain bone homeostasis. However, in individuals with cystic fibrosis, this balance can be disrupted, leading to a reduction in bone density, but the exact mechanism is not well understood. Mice carrying the F508del CFTR mutation demonstrate reduced osteoblast differentiation and function, as reported by Le Henaff et al., (2015). These effects are associated with increased NF-κB activity and decreased Wnt/β-catenin signaling. In this study, we observed that the osteogenic capacity of DPSCs can vary depending on the specific mutations present in the CFTR gene. DPSCs with homozygous mutations in the CFTR gene (F508del) demonstrated enhanced osteogenic capacity, whereas DPSCs with heterozygous mutations (F508del and R347H) exhibited reduced osteogenic capacity compared to healthy DPSCs. The functional impact of CFTR mutations, such as the βV348M mutation for example, may play a significant role in the pathophysiology of CF by dysregulating sodium and fluid absorption in the respiratory tract [22]. Furthermore, the combined effects of two mutations in cis can have a profound impact on CFTR function, contributing to the extensive phenotypic variability observed in CF. For instance, the coexistence of R347H and D979A mutations leads to a synergistic impairment of Cl (-) current, resulting in a significant decrease in CFTR function [23]. Certain genetic mutations can have a significant impact on the proper folding of a protein, leading to alterations in its three-dimensional structure or in post-translational modification sites crucial for protein function. These structural changes can affect protein stability, the ability to interact with other molecules, or even modify its enzymatic activity. Additionally, mutations may result in the exposure of new domains in the protein, allowing interactions with other signaling pathways that would not normally occur. These additional interactions can trigger altered signaling cascades, affecting various cellular processes such as proliferation, differentiation, and cell survival. Therefore, it is important to recognize that protein mutations can have effects beyond their direct function, potentially influencing the interaction with other signaling pathways and contributing to the complexity of genetic diseases.
The expression of osteogenesis markers, such as RUNX2 and OPG, undergoes modulation during the 7-day osteogenic differentiation period. Notably, at the early stages of osteogenesis, DPSCs homozygous for the F508del mutation exhibit higher expression levels of RUNX2 compared to other induced DPSCs. Robert et al., (2018) reported that RUNX2 was not detected in MSCs committed to osteoblast lineage after 24 hours of osteogenic induction. Furthermore, other studies have indicated that the expression of RUNX2 becomes evident at later stages of osteogenic differentiation [25]. Specifically, RUNX2 type I has been associated with early osteoblastogenesis, while RUNX2 type II is necessary for the terminal stages of osteoblastic maturation [26], [27]. In this study, the oligonucleotides used to detect RUNX2 expression can recognize all isoforms of RUNX2 mRNA, providing a general overview of gene expression. However, it should be noted that this approach cannot distinguish the specific isoform expressed at each stage. Interestingly, the expression of OPG shows an inverse relationship with RUNX2 expression. OPG is a member of the TNF receptor superfamily that acts as a dose-dependent inhibitor of osteoclast differentiation from precursor cells [28] corroborating these findings, Le Henaff et al. (2015) demonstrated a significant reduction in the mRNA level of OPG in osteoblasts derived from F508del-CFTR mice compared to osteoblasts from WT mice. In individuals homozygous for the F508del mutation in the CFTR gene, there appears to be an impact on osteogenesis, promoting osteoblast formation. Consequently, at a systemic level and over the long term, the imbalance between osteoclastogenesis and osteogenesis resulting from altered OPG expression by DPSCs could contribute to the development of osteoporosis and osteopenia in cystic fibrosis. These findings suggest that DPSCs from CF donors display distinct gene expression patterns related to osteogenesis compared to DPSCs from healthy donors and those with different genotypes. Further research is needed to fully understand the underlying mechanisms and to develop effective treatments for the bone complications associated with CF.
An important limitation of this study is the reduced number of donors included in each cystic fibrosis variant group. This limitation arises from the inherent difficulty in obtaining biological samples from patients with specific genotypes, since the frequency of certain mutations in the population is relatively low. In addition, the process of sample collection and cell isolation depends on donor availability and sample viability, which further restricts the final sample size. Nevertheless, the data obtained are consistent and allow the observation of relevant trends, although they should be interpreted with caution and validated in future studies with larger cohorts.
DPSCs from CF patients were successfully established and exhibited normal immunophenotype and proliferation, but their osteogenic potential varied according to CFTR genotype. Distinct RUNX2 and OPG expression profiles highlight genotype-specific modulation of osteogenesis, underscoring a potential role for CFTR mutations in CF-associated bone fragility.
The authors would like to acknowledge the Program for Technological Development in Tools for Health-PDTIS FIOCRUZ for use of its facilities.
Competing interests
The authors report that there are no potential conflicts of interest or financial interests.
Funding
This work was supported by FIOCRUZ (Inova VPPCB-008-FIO-18) and National Council for Scientific and Technological Development – CNPq (Proep 442324/2019-7). PS received grant from the National Council for Scientific and Technological Development (CNPq – Grant Holder PQ 303742/2022-4).
Authors' contributions
EBS carried out cellular and molecular studies. FB and CLKR carried out DPSC isolation. JBL and LB carried out cell culture. CAR, MM, and NRF carried out patient recruitment. RGJ performed qPCR tests. PS carried out the cytometry experiments. EBS and PS drafted the manuscript. All authors read and approved the final manuscript.
Declaration of generative AI and AI-assisted technologies in the writing process
During the preparation of this work the author(s) used ChatGPT to improve the clarity and understanding of the text. After using this tool/service, the author(s) reviewed and edited the content as needed and take(s) full responsibility for the content of the publication.
Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.
Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.
Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.
Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.
We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.
The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.
Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.
Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.
Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.
Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.
Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.
This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.
Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.
As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.
Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.
International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.
Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.
Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.
I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!
"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".
I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.
We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.
I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.
I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.
I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.
Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.
“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.
Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.
Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.
Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.
The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.
Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.
Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.
Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”
Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner
My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.
My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.
My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.
I would like to offer my testimony in the support. I have received through the peer review process and support the editorial office where they are to support young authors like me, encourage them to publish their work in your esteemed journals, and globalize and share knowledge globally. I really appreciate your journal, peer review, and editorial office.
Dear Agrippa Hilda- Editorial Coordinator of Journal of Neuroscience and Neurological Surgery, "The peer review process was very quick and of high quality, which can also be seen in the articles in the journal. The collaboration with the editorial office was very good."
I would like to express my sincere gratitude for the support and efficiency provided by the editorial office throughout the publication process of my article, “Delayed Vulvar Metastases from Rectal Carcinoma: A Case Report.” I greatly appreciate the assistance and guidance I received from your team, which made the entire process smooth and efficient. The peer review process was thorough and constructive, contributing to the overall quality of the final article. I am very grateful for the high level of professionalism and commitment shown by the editorial staff, and I look forward to maintaining a long-term collaboration with the International Journal of Clinical Case Reports and Reviews.
To Dear Erin Aust, I would like to express my heartfelt appreciation for the opportunity to have my work published in this esteemed journal. The entire publication process was smooth and well-organized, and I am extremely satisfied with the final result. The Editorial Team demonstrated the utmost professionalism, providing prompt and insightful feedback throughout the review process. Their clear communication and constructive suggestions were invaluable in enhancing my manuscript, and their meticulous attention to detail and dedication to quality are truly commendable. Additionally, the support from the Editorial Office was exceptional. From the initial submission to the final publication, I was guided through every step of the process with great care and professionalism. The team's responsiveness and assistance made the entire experience both easy and stress-free. I am also deeply impressed by the quality and reputation of the journal. It is an honor to have my research featured in such a respected publication, and I am confident that it will make a meaningful contribution to the field.
"I am grateful for the opportunity of contributing to [International Journal of Clinical Case Reports and Reviews] and for the rigorous review process that enhances the quality of research published in your esteemed journal. I sincerely appreciate the time and effort of your team who have dedicatedly helped me in improvising changes and modifying my manuscript. The insightful comments and constructive feedback provided have been invaluable in refining and strengthening my work".
I thank the ‘Journal of Clinical Research and Reports’ for accepting this article for publication. This is a rigorously peer reviewed journal which is on all major global scientific data bases. I note the review process was prompt, thorough and professionally critical. It gave us an insight into a number of important scientific/statistical issues. The review prompted us to review the relevant literature again and look at the limitations of the study. The peer reviewers were open, clear in the instructions and the editorial team was very prompt in their communication. This journal certainly publishes quality research articles. I would recommend the journal for any future publications.
Dear Jessica Magne, with gratitude for the joint work. Fast process of receiving and processing the submitted scientific materials in “Clinical Cardiology and Cardiovascular Interventions”. High level of competence of the editors with clear and correct recommendations and ideas for enriching the article.
We found the peer review process quick and positive in its input. The support from the editorial officer has been very agile, always with the intention of improving the article and taking into account our subsequent corrections.
My article, titled 'No Way Out of the Smartphone Epidemic Without Considering the Insights of Brain Research,' has been republished in the International Journal of Clinical Case Reports and Reviews. The review process was seamless and professional, with the editors being both friendly and supportive. I am deeply grateful for their efforts.
To Dear Erin Aust – Editorial Coordinator of Journal of General Medicine and Clinical Practice! I declare that I am absolutely satisfied with your work carried out with great competence in following the manuscript during the various stages from its receipt, during the revision process to the final acceptance for publication. Thank Prof. Elvira Farina
Dear Jessica, and the super professional team of the ‘Clinical Cardiology and Cardiovascular Interventions’ I am sincerely grateful to the coordinated work of the journal team for the no problem with the submission of my manuscript: “Cardiometabolic Disorders in A Pregnant Woman with Severe Preeclampsia on the Background of Morbid Obesity (Case Report).” The review process by 5 experts was fast, and the comments were professional, which made it more specific and academic, and the process of publication and presentation of the article was excellent. I recommend that my colleagues publish articles in this journal, and I am interested in further scientific cooperation. Sincerely and best wishes, Dr. Oleg Golyanovskiy.
Dear Ashley Rosa, Editorial Coordinator of the journal - Psychology and Mental Health Care. " The process of obtaining publication of my article in the Psychology and Mental Health Journal was positive in all areas. The peer review process resulted in a number of valuable comments, the editorial process was collaborative and timely, and the quality of this journal has been quickly noticed, resulting in alternative journals contacting me to publish with them." Warm regards, Susan Anne Smith, PhD. Australian Breastfeeding Association.
Dear Jessica Magne, Editorial Coordinator, Clinical Cardiology and Cardiovascular Interventions, Auctores Publishing LLC. I appreciate the journal (JCCI) editorial office support, the entire team leads were always ready to help, not only on technical front but also on thorough process. Also, I should thank dear reviewers’ attention to detail and creative approach to teach me and bring new insights by their comments. Surely, more discussions and introduction of other hemodynamic devices would provide better prevention and management of shock states. Your efforts and dedication in presenting educational materials in this journal are commendable. Best wishes from, Farahnaz Fallahian.
Dear Maria Emerson, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews, Auctores Publishing LLC. I am delighted to have published our manuscript, "Acute Colonic Pseudo-Obstruction (ACPO): A rare but serious complication following caesarean section." I want to thank the editorial team, especially Maria Emerson, for their prompt review of the manuscript, quick responses to queries, and overall support. Yours sincerely Dr. Victor Olagundoye.
Dear Ashley Rosa, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews. Many thanks for publishing this manuscript after I lost confidence the editors were most helpful, more than other journals Best wishes from, Susan Anne Smith, PhD. Australian Breastfeeding Association.
Dear Agrippa Hilda, Editorial Coordinator, Journal of Neuroscience and Neurological Surgery. The entire process including article submission, review, revision, and publication was extremely easy. The journal editor was prompt and helpful, and the reviewers contributed to the quality of the paper. Thank you so much! Eric Nussbaum, MD
Dr Hala Al Shaikh This is to acknowledge that the peer review process for the article ’ A Novel Gnrh1 Gene Mutation in Four Omani Male Siblings, Presentation and Management ’ sent to the International Journal of Clinical Case Reports and Reviews was quick and smooth. The editorial office was prompt with easy communication.
Dear Erin Aust, Editorial Coordinator, Journal of General Medicine and Clinical Practice. We are pleased to share our experience with the “Journal of General Medicine and Clinical Practice”, following the successful publication of our article. The peer review process was thorough and constructive, helping to improve the clarity and quality of the manuscript. We are especially thankful to Ms. Erin Aust, the Editorial Coordinator, for her prompt communication and continuous support throughout the process. Her professionalism ensured a smooth and efficient publication experience. The journal upholds high editorial standards, and we highly recommend it to fellow researchers seeking a credible platform for their work. Best wishes By, Dr. Rakhi Mishra.
Dear Jessica Magne, Editorial Coordinator, Clinical Cardiology and Cardiovascular Interventions, Auctores Publishing LLC. The peer review process of the journal of Clinical Cardiology and Cardiovascular Interventions was excellent and fast, as was the support of the editorial office and the quality of the journal. Kind regards Walter F. Riesen Prof. Dr. Dr. h.c. Walter F. Riesen.
Dear Ashley Rosa, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews, Auctores Publishing LLC. Thank you for publishing our article, Exploring Clozapine's Efficacy in Managing Aggression: A Multiple Single-Case Study in Forensic Psychiatry in the international journal of clinical case reports and reviews. We found the peer review process very professional and efficient. The comments were constructive, and the whole process was efficient. On behalf of the co-authors, I would like to thank you for publishing this article. With regards, Dr. Jelle R. Lettinga.
Dear Clarissa Eric, Editorial Coordinator, Journal of Clinical Case Reports and Studies, I would like to express my deep admiration for the exceptional professionalism demonstrated by your journal. I am thoroughly impressed by the speed of the editorial process, the substantive and insightful reviews, and the meticulous preparation of the manuscript for publication. Additionally, I greatly appreciate the courteous and immediate responses from your editorial office to all my inquiries. Best Regards, Dariusz Ziora
Dear Chrystine Mejia, Editorial Coordinator, Journal of Neurodegeneration and Neurorehabilitation, Auctores Publishing LLC, We would like to thank the editorial team for the smooth and high-quality communication leading up to the publication of our article in the Journal of Neurodegeneration and Neurorehabilitation. The reviewers have extensive knowledge in the field, and their relevant questions helped to add value to our publication. Kind regards, Dr. Ravi Shrivastava.
Dear Clarissa Eric, Editorial Coordinator, Journal of Clinical Case Reports and Studies, Auctores Publishing LLC, USA Office: +1-(302)-520-2644. I would like to express my sincere appreciation for the efficient and professional handling of my case report by the ‘Journal of Clinical Case Reports and Studies’. The peer review process was not only fast but also highly constructive—the reviewers’ comments were clear, relevant, and greatly helped me improve the quality and clarity of my manuscript. I also received excellent support from the editorial office throughout the process. Communication was smooth and timely, and I felt well guided at every stage, from submission to publication. The overall quality and rigor of the journal are truly commendable. I am pleased to have published my work with Journal of Clinical Case Reports and Studies, and I look forward to future opportunities for collaboration. Sincerely, Aline Tollet, UCLouvain.
Dear Ms. Mayra Duenas, Editorial Coordinator, International Journal of Clinical Case Reports and Reviews. “The International Journal of Clinical Case Reports and Reviews represented the “ideal house” to share with the research community a first experience with the use of the Simeox device for speech rehabilitation. High scientific reputation and attractive website communication were first determinants for the selection of this Journal, and the following submission process exceeded expectations: fast but highly professional peer review, great support by the editorial office, elegant graphic layout. Exactly what a dynamic research team - also composed by allied professionals - needs!" From, Chiara Beccaluva, PT - Italy.
Dear Maria Emerson, Editorial Coordinator, we have deeply appreciated the professionalism demonstrated by the International Journal of Clinical Case Reports and Reviews. The reviewers have extensive knowledge of our field and have been very efficient and fast in supporting the process. I am really looking forward to further collaboration. Thanks. Best regards, Dr. Claudio Ligresti
Dear Chrystine Mejia, Editorial Coordinator, Journal of Neurodegeneration and Neurorehabilitation. “The peer review process was efficient and constructive, and the editorial office provided excellent communication and support throughout. The journal ensures scientific rigor and high editorial standards, while also offering a smooth and timely publication process. We sincerely appreciate the work of the editorial team in facilitating the dissemination of innovative approaches such as the Bonori Method.” Best regards, Dr. Matteo Bonori.
I recommend without hesitation submitting relevant papers on medical decision making to the International Journal of Clinical Case Reports and Reviews. I am very grateful to the editorial staff. Maria Emerson was a pleasure to communicate with. The time from submission to publication was an extremely short 3 weeks. The editorial staff submitted the paper to three reviewers. Two of the reviewers commented positively on the value of publishing the paper. The editorial staff quickly recognized the third reviewer’s comments as an unjust attempt to reject the paper. I revised the paper as recommended by the first two reviewers.
Dear Maria Emerson, Editorial Coordinator, Journal of Clinical Research and Reports. Thank you for publishing our case report: "Clinical Case of Effective Fetal Stem Cells Treatment in a Patient with Autism Spectrum Disorder" within the "Journal of Clinical Research and Reports" being submitted by the team of EmCell doctors from Kyiv, Ukraine. We much appreciate a professional and transparent peer-review process from Auctores. All research Doctors are so grateful to your Editorial Office and Auctores Publishing support! I amiably wish our article publication maintained a top quality of your International Scientific Journal. My best wishes for a prosperity of the Journal of Clinical Research and Reports. Hope our scientific relationship and cooperation will remain long lasting. Thank you very much indeed. Kind regards, Dr. Andriy Sinelnyk Cell Therapy Center EmCell
Dear Editorial Team, Clinical Cardiology and Cardiovascular Interventions. It was truly a rewarding experience to work with the journal “Clinical Cardiology and Cardiovascular Interventions”. The peer review process was insightful and encouraging, helping us refine our work to a higher standard. The editorial office offered exceptional support with prompt and thoughtful communication. I highly value the journal’s role in promoting scientific advancement and am honored to be part of it. Best regards, Meng-Jou Lee, MD, Department of Anesthesiology, National Taiwan University Hospital.
Dear Editorial Team, Journal-Clinical Cardiology and Cardiovascular Interventions, “Publishing my article with Clinical Cardiology and Cardiovascular Interventions has been a highly positive experience. The peer-review process was rigorous yet supportive, offering valuable feedback that strengthened my work. The editorial team demonstrated exceptional professionalism, prompt communication, and a genuine commitment to maintaining the highest scientific standards. I am very pleased with the publication quality and proud to be associated with such a reputable journal.” Warm regards, Dr. Mahmoud Kamal Moustafa Ahmed
Dear Maria Emerson, Editorial Coordinator of ‘International Journal of Clinical Case Reports and Reviews’, I appreciate the opportunity to publish my article with your journal. The editorial office provided clear communication during the submission and review process, and I found the overall experience professional and constructive. Best regards, Elena Salvatore.
Dear Mayra Duenas, Editorial Coordinator of ‘International Journal of Clinical Case Reports and Reviews Herewith I confirm an optimal peer review process and a great support of the editorial office of the present journal
Dear Editorial Team, Clinical Cardiology and Cardiovascular Interventions. I am really grateful for the peers review; their feedback gave me the opportunity to reflect on the message and impact of my work and to ameliorate the article. The editors did a great job in addition by encouraging me to continue with the process of publishing.
Dear Cecilia Lilly, Editorial Coordinator, Endocrinology and Disorders, Thank you so much for your quick response regarding reviewing and all process till publishing our manuscript entitled: Prevalence of Pre-Diabetes and its Associated Risk Factors Among Nile College Students, Sudan. Best regards, Dr Mamoun Magzoub.
International Journal of Clinical Case Reports and Reviews is a high quality journal that has a clear and concise submission process. The peer review process was comprehensive and constructive. Support from the editorial office was excellent, since the administrative staff were responsive. The journal provides a fast and timely publication timeline.
Dear Mayra Duenas, Editorial Coordinator of the journal IJCCR, I write here a little on my experience as an author submitting to the International Journal of Clinical Case Reports and Reviews (IJCCR). This was my first submission to IJCCR and my manuscript was inherently an outsider’s effort. It attempted to broadly identify and then make some sense of life’s under-appreciated mysteries. I initially had responded to a request for possible submissions. I then contacted IJCCR with a tentative topic for a manuscript. They quickly got back with an approval for the submission, but with a particular requirement that it be medically relevant. I then put together a manuscript and submitted it. After the usual back-and-forth over forms and formality, the manuscript was sent off for reviews. Within 2 weeks I got back 4 reviews which were both helpful and also surprising. Surprising in that the topic was somewhat foreign to medical literature. My subsequent updates in response to the reviewer comments went smoothly and in short order I had a series of proofs to evaluate. All in all, the whole publication process seemed outstanding. It was both helpful in terms of the paper’s content and also in terms of its efficient and friendly communications. Thank you all very much. Sincerely, Ted Christopher, Rochester, NY.
Dear Grace Pierce, Editorial Coordinator of the journal IJCCR, I had a very positive experience with Auctores - Journal throughout the publication process. The Editorial Team was highly responsive, professional, and supportive at every stage. I would like to extend my sincere thanks to the Editor: Grace Pierce, for her guidance and assistance. The peer-review process was smooth and constructive, helping improve the quality of my work. I would gladly recommend Auctores Journal to fellow researchers and authors. Dr. SABITA SINHA, Medical Oncologist, MD (Electro Homeopathy).
Dear Maria Emerson, Editorial Coordinator of - Journal of Clinical Research and Reports. ''I am pleased to provide this testimonial following the publication of our recent case report in this journal. The peer review process was rigorous, constructive, thorough, and conducted in a timely manner. The reviewers’ comments were thoughtful, detailed, and highly constructive, contributing substantially to the refinement, clarity, and scientific robustness of our manuscript. The process was conducted with professionalism and academic integrity throughout. The support provided by the editorial office was exemplary. Communication was consistently prompt, clear, and courteous at all stages of the submission and publication process. The editorial team demonstrated a high level of organization and responsiveness, ensuring that all queries were addressed efficiently and that the process remained transparent and well-coordinated. The overall quality of the journal is reflected in its strong editorial standards, commitment to scientific excellence, and dedication to publishing clinically meaningful research. It has been a privilege to publish our work in this journal, and we would welcome the opportunity to contribute further in the future.'' Best wishes from, Dr. Efstratios Trogkanis, Cardiologist.
Dear Reader: We have published several articles in the Auctores Publishing, LLC, journal, Clinical Medical Reviews and Reports in recent years (CMRR). This is an ‘open access’ journal and the following are our observations. From the initial invitation to submit an article, to the final edits of galley proofs, we have found CMRR personnel to be professional, responsive, rapid and thorough. This entire process begins with Catherine Mitchell, Editorial Coordinator. She is simply outstanding, and, I believe, unparalleled in her capacity. I cannot imagine a more responsive and dedicated Editorial Coordinator. As I read the dates and timing of her correspondence with us, it seems that she never sleeps. I hope Auctores Publishing, LLC, appreciates her efforts as much as these authors do. Thank you to Auctores Publishing, LLC, to the Editorial Staff/Board, and to Catherine Mitchell from a grateful author(s).
Dear Maria Emerson, Editorial Coordinator of International Journal of Clinical Case Reports and Reviews, What distinguishes International Journal of Clinical Case Report and Review is not only the scientific rigor of its publications, but the intellectual climate in which research is evaluated. The submission process is refreshingly free of unnecessary formal barriers and bureaucratic rituals that often complicate academic publishing without adding real value. The peer-review system is demanding yet constructive, guided by genuine scientific dialogue rather than hierarchical or authoritarian attitudes. Reviewers act as collaborators in improving the manuscript, not as gatekeepers imposing arbitrary standards. This journal offers a rare balance: high methodological standards combined with a respectful, transparent, and supportive editorial approach. In an era where publishing can feel more burdensome than research itself, this platform restores the original purpose of peer review — to refine ideas, not to obstruct them Prof. Perlat Kapisyzi, FCCP PULMONOLOGIST AND THORACIC IMAGING.
Dear Mercy Grace, Editorial Coordinator of Obstetrics Gynecology and Reproductive Sciences, We would like to express our gratitude for your help at all stages of publishing and editing the article. The editors of the magazine answer all the necessary questions and help at every stage. We will definitely continue to cooperate and publish other works in the Obstetrics Gynecology and Reproductive Sciences! Best wishes from, Alla Konstantinovna Politova,