AUCTORES
Globalize your Research
Research Article | DOI: https://doi.org/10.31579/2641-0419/388
1Centre for Cellular and Molecular Biology, Hyderabad, Telangana, India.
2Gandhi Medical College, Hyderabad, Telangana, India.
1,3University of Geneva Hospital, Geneva, Switzerland.
4Department of National Institute of Mental Health and Neurosciences, Bengaluru, India.
5Department of Experimental Medicine and Biotechnology, PGIMER, Chandigarh, India.
6Department of Genetics, Osmania University, Hyderabad, Telangana, India.
*Corresponding Author: Deepa Selvi Rani and Kumarasamy Thangaraj, Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad-500 007, India.
Citation: Deepa S. Rani, Abhishek Thangaraj, Archana V. Kumar, Periyasamy Govindaraj, Madhu Khullar, et al, (2024), A Common 5bp (CTTCT) Deletion Polymorphism in TNNT2 is Significantly Associated with Hypertrophic Cardiomyopathy, J Clinical Cardiology and Cardiovascular Interventions, 7(8); DOI: 10.31579/2641-0419/388
Copyright: © 2024, Deepa Selvi Rani. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Received: 27 June 2024 | Accepted: 31 July 2024 | Published: 12 August 2024
Keywords: HCM; Hypertrophic Cardiomyopathy; 5bp polymorphism; TNNT2; allele frequency; genotype frequency
Troponin T is a component of the Troponin complex, which plays a major role in the regulation of myocardial contraction in response to changes in the intracellular Ca2+ion concentration. Deletion of 5bp (CTTCT) in the polypyrimidine tract of intron 3 of the cardiac Troponin T gene (TNNT2) results in cTnT2 and cTnT4 isoforms by skipping of exon 4, which was reported to be associated with hypertrophic cardiomyopathy (HCM). In the present study, we screened a common 5bp deletion polymorphism in TNNT2 gene using direct sequencing in 178 cardiomyopathy patients with significant LV hypertrophy from North India against 197 ethnically matched and clinically well-characterized healthy controls. Our study revealed a high frequency of del/del genotype in patients with HCM vs controls (p=0.000007). The deletion and insertion allele frequencies in patients and controls were (75% & 25%) and (56% & 44%), respectively. Further, analysis of 2056 caste and tribe groups belonging to highly diverse endogamous people inhabited in different states of India have revealed higher deletion allele frequency in both South and North Indian states compare to control group whereas the North-eastern states showed a slightly higher frequency of insertion allele. In conclusion, the deletion allele frequency in the HCM patient group is found to be significantly higher than the control group (p=<.0001). Therefore, the deletion allele frequency is not only associated with LV hypertrophy in Japanese, French, and South Indian HCM patients but also in North Indian HCM patients.
Studies have reported four isoforms of human cardiac Troponin T (cTnT) in myocardial muscle [1]. The cTnT3 (missing exon 5) is a major mRNA isoform of a normal adult heart and cTnT4 (missing exons 4 and 5) is a minor isoform and the cTnT1 (all exons present) and cTnT2 (missing exon 4) mRNAs isoforms are found to be expressed in a barely detectable quantity [2 3]. The four isoforms are reported to be a result of alternative splicing of a single gene Troponin T (TNNT2), which is located on chromosome 1q32 [4-7]. Farza et al have described the sequence and the organization of the TNNT2 gene and a possible mechanism by which some of the cTnT mRNA are generated [8].
In humans, pre-mRNA splicing involves the removal of introns and the ligation of the exons forming mature mRNA. Accurate removal of introns required several cis-acting sequences and trans-acting factors. The polypyrimidine tract is one of the important cis-acting sequence elements, which dictate the removal of the intron from pre-mRNA splicing. Deletion of 5bp (CTTCT) at the polypyrimidine tract in intron 3 of the TNNT2 gene AApolymorphism significantly affects the mRNA expression pattern by skipping exon 4 during splicing; it has been proved by in vitro mRNA (mini gene construct) expression study [11]. The missing exon 4 in cardiac Troponin T corresponding to isoforms cTnT2 and cTnT4, and the isoform cTnT4 have been reported in failing hearts [4 5]. The two isoforms cTnT2 and cTnT4 are found to be functionally distinct based on the structure, Ca2+ sensitivity, and inhibition of force development [1].
India is known for its genetic diversity, a high level of endogamy created by social boundaries within and between castes and tribes, along with the influence of evolutionary forces such as long-term isolation, fragmentation, and genetic drift has kept the Indian populations diverse and distant from each other [12 13]. Previously, we reported 5bp (del/del) polymorphism and its association in South Indian HCM cases [14]. In the present study, we screened the frequency of 5bp (del/del) polymorphism in North Indian Hypertrophic Cardiomyopathies (HCM).
Patients, controls, and population samples
A total of 178 unrelated cardiomyopathy patients with significant LV hypertrophy from North India were included in this study. All the patients fulfilled the selection criteria, based on electrocardiographic and echocardiographic measurements, without hypertension or the patient currently not on any anti-hypertensive medications were recruited from the Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India, (Table 1), along with one ninety-seven healthy normal individuals from the same ethnic background, without hypertension and cardiomyopathy as controls based on the electrocardiographic and echocardiographic measurements.
DNA isolation
DNA was isolated from the samples using the following protocol: Erythrocytes were lysed with 15.0 ml of erythrocyte lysis buffer for 5 minutes (10 mM Tris pH 8.0, 320 mM sucrose, 5 mM MgCl2, 1% Triton X-100; Sigma Chemical Company, St Louis, MO, USA). After complete lysis, the leukocytes were pelleted by centrifugation. The leukocyte pellet was dissolved in 8.0 ml of leukocyte lysis buffer (400 mM Tris, 60 mM EDTA, 150 mM NaCl, and 1% SDS; Sigma) and mixed thoroughly. To this, 2.0 ml of 5M sodium perchlorate (E. Merck, Darmstadt, Germany) was added and mixed thoroughly for 2–3 minutes. The DNA of both the patients and the controls was Precipitated by extracting once with phenol: chloroform, and again with chloroform. The precipitated DNA was then washed with 70% ethanol and dissolved in TE buffer (10 mM Tris pH 8.0, 1 mM EDTA).
PCR assay for 5bp (del/del; ins/del; ins/ins) Genotyping
A pair of primers to amplify the exons 3 and 4 of TNNT2gene, covering the exons and exon boundaries of TNNT2 were designed and synthesized using an ABI 392 Oligo synthesizer (Perkin-Elmer. Foster City. CA). The nucleotide sequence of both FP (forward primer) TNNT2: 3F = (5'atgagaacggcaggccaggctagtg 3') and the RP (reverse primer) TNNT2: 4R = (5’gtttgcctcaagacccgagcaacc 3’). PCR of each sample was set in a 0.2ml thin-wall tube using 5.0 ng of DNA, 10 pM of each primer, 200 mM of dNTPs, 1X PCR buffer containing 1.5 mM MgCl2 and 2U of AmpliTaq Gold (Perkin Elmer). The cycling conditions used for amplification are as follows: initial denaturation at 940C for 1 min followed by 30 cycles of denaturation for 45 sec at 940C, annealing for 40 sec at 580C, and extension for 37 sec at 700C (final extension for 7 min).
Sequencing of the PCR amplicon
The PCR amplicon was directly sequenced using 50.0 ng (2.0 ml) of PCR product and 2 pM (0.5ml) of primer, 2.0 ml of BigDye Terminator (v3.1) ready reaction mix (Perkin Elmer), and 0.5ml of double distilled water (DDW) to make up the volume to 5.0ml. The PCR cycle sequencing was carried out in a GeneAmp 9600 Thermal cycler (Perkin Elmer) employing the following conditions: 960C for 10 seconds, 550C for 5 seconds, and 600C for 4 minutes for 30 cycles. Extended products have been purified and dissolved in 10 ml of 50% Hi-Di formamide to analyze in an ABI 3730 Genetic Analyzer (Perkin Elmer, Foster City, CA, USA).
Statistical analysis
Chi-square χ2 test and odds ratio were carried out and obtained p-value to analyze (http://faculty.vassar.edu/lowry/VassarStats.html) the significance of the 5bp (D/D, I/D, I/I) polymorphism in HCM patients and controls of Indian origin.
In humans, myocardial TnT expression has been found to influence the disease pathogenesis and development. Studies have reported that the human myocardium has expressed in four TnT isoforms (Figure.1). In the present study, we screened a five bp (del/del) polymorphism in the TNNT2 gene (Figure.2) in 178 unrelated hypertrophy cardiomyopathy patients from North India (Table 1), against 197 ethnically matched and clinically well-characterized controls. We analysed the genotype and the allele frequencies in HCM patients from North India against controls (Tables 2 and 3). We found significantly higher del/del genotype (64%) and deletion allele (75%) frequencies in HCM patients (Tables 2 and 3). The frequencies of del/del; del/ins; ins/ins genotypes in the HCM patients were 64%, 22%, and 14 %, respectively (Table 2), whereas, in the control group, they were 41%, 30%, and 29%, respectively (Table 2). The del/del genotype frequency in the hypertrophy patients showed significantly higher P value (P=0.000007) than that of the control group (Table 2). The frequency of deletion and insertion alleles in patients were 75% and 25%, respectively (Table 3), whereas in the control group, they were 56% and 44%, respectively (Table 3). The deletion allele frequency in hypertrophic patient group was significantly higher than that of the control group (p=<.0001) (Table 3).
Table 1: Clinical features of Hypertrophic cardiomyopathy patients studied
Table 2: Genotype Frequency of a common 5bp Polymorphism (D/D, I/D, I/I) in TNNT2- Observed in Hypertrophic Cardiomyopathy Patients from North India
Table 3. Allele Frequency of a common 5bp Polymorphism (Deletion/Insertion) in TNNT2- Observed in Hypertrophic Cardiomyopathy Patients from North India
Further, analysis of 2056 caste and tribe groups belonging to highly diverse endogamous populations inhabited in different states of India has revealed their 5bp del/del polymorphism frequencies (Table 4). Interestingly, the frequency of del/del genotype was high in Beastha Chaurasia, Gamit, Jain Meena, Subba, and Great Andamanese as compared to the controls.
However, the insertion allele frequency found to be high in Nishi, Ao-Naga, Chakesang Naga, Mizo, Kandha, Sah, mixed people from West Bengal, Siddis from Gujarat and Karnataka, Medar from Karnataka and Onges of the Andaman Island (Table 4). Our study revealed a very high del/del genotype and deletion allele frequency in HCM (Table 2 and 3), compared to most of the diverse people from different states of India (Table 4).
The human myocardium has the potential to express multiple TnT isoforms. The major TnT isoforms expressed in the failing human heart are the products of alternative splicing of mRNA [15] (Figure.1), rather than post-translational modifications of a single protein or the result of proteolysis [4]. The basis of TnT isoform expression in chicken and rat [13] hearts and rabbit,[16] rat, [17] and avian [18] skeletal muscles are the result of alternative splicing
Table 4. Genotype and Allele frequency of a common 5bp (D/D, I/D, I/I) Polymorphism Detected in Caste and Tribe groups belonging to different states of India
(Figure.2). The C/T polymorphism in intronic polypyrimidine tract was found to influence splicing [19]. The polypyrimidine tract is one of the important cis-acting sequence elements directing intron removal in pre-mRNA splicing, however, the deletion of the polypyrimidine tract has been found to abolish correct lariat formation, spliceosome assembly, and thus the alternate splicing results in skipping of exon [7,8].
The 5bp (CTTCT) polymorphism in intron 3 of TNNT2 was reported to be in the polypyrimidine tract sequence which results in the skipping of exon 4, located downstream of this polymorphism [6,9]. Missing exon 4 in cardiac TNNT2 corresponds to isoforms cTnT2 and cTnT4, and found to be elevated in heart failure and the fetal heart [3-5]. The 5bp deletion polymorphism reported in the French population was found to be influencing the splicing accuracy and efficiency, although the clinical significance of this polymorphism has not been elucidated [6]. The minigene construct (in vitro mRNA expression) has shown that the 5bp deletion had affected the mRNA expression pattern by skipping of exon four cardiac TNNT2 [9].
We have therefore screened the 5bp (D/D, D/I, I/I) polymorphism in the intron 3 of the TNNT2 gene in North Indian HCM patients and found that the deletion (del/del) genotype and the deletion allele frequencies were significantly higher in the hypertrophic cases, compared to the healthy controls. Hence, the del/del genotype (73%) might be associated with prominent concentric LV hypertrophy in such cases. The difference in deletion allele frequencies between the patients (HCM) and healthy controls has shown a statistically significant p-value (p=0.000172).
In Japanese patients, the frequency of insertion and deletion alleles in the HCM was 33.1 and 66.9%, respectively [9]. Our study revealed that the del/del genotype frequency in North Indians are 75% higher than that of the Japanese patients, suggesting a strong association. This indicates that the 5bp del/del genotype and the deletion alleles of Troponin T2 are associated with a predisposition to prominent left ventricular hypertrophy not only in French, Japanese, and South Indian patients but also in North Indian HCM patients.
Most Indians descend from a mixture of two genetically divergent populations: Ancestral North Indians (ANI) and Ancestral South Indians (ASI)[10]. Our study of 2056 Caste and Tribe groups belonging to highly diverse endogamous populations inhabited in different states of India showed that the frequency of 5bp (del/del) polymorphism was significantly higher not only in South Indians but also in North Indians (p=0.000535). Therefore, our study helps to understand the frequency of 5bp (del/del) polymorphism in the admixture of the Indian population. In conclusion, the TNNT2 del/del genotype and the deletion allele frequency are not only associated with LV hypertrophy in Japanese, French, and South Indian hypertrophic cardiomyopathy but also in HCM patients from North India.
We thank all the volunteers (hypertrophic cardiomyopathy patients and healthy controls) who donated their blood samples for this study.
The authors have declared that there is no conflict of interest exist.
D. S. Rani is salaried through CSIR_CCMB, Hyderabad, India. CSIR/CCMB funded this project. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.
Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.
Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.
Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.
We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.
The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.
Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.
Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.
Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.
Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.
Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.
This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.
Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.
As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.
Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.
International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.
Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.
Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.
I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!
"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".
I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.
We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.
I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.
I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.
I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.
Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.
“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.
Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.
Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.
Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.
The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.
Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.
Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.
Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, The review process for the article “The Handling of Anti-aggregants and Anticoagulants in the Oncologic Heart Patient Submitted to Surgery” was extremely rigorous and detailed. From the initial submission to the final acceptance, the editorial team at the “Journal of Clinical Cardiology and Cardiovascular Interventions” demonstrated a high level of professionalism and dedication. The reviewers provided constructive and detailed feedback, which was essential for improving the quality of our work. Communication was always clear and efficient, ensuring that all our questions were promptly addressed. The quality of the “Journal of Clinical Cardiology and Cardiovascular Interventions” is undeniable. It is a peer-reviewed, open-access publication dedicated exclusively to disseminating high-quality research in the field of clinical cardiology and cardiovascular interventions. The journal's impact factor is currently under evaluation, and it is indexed in reputable databases, which further reinforces its credibility and relevance in the scientific field. I highly recommend this journal to researchers looking for a reputable platform to publish their studies.
Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”
Dealing with The Journal of Neurology and Neurological Surgery was very smooth and comprehensive. The office staff took time to address my needs and the response from editors and the office was prompt and fair. I certainly hope to publish with this journal again.Their professionalism is apparent and more than satisfactory. Susan Weiner
My Testimonial Covering as fellowing: Lin-Show Chin. The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews.
My experience publishing in Psychology and Mental Health Care was exceptional. The peer review process was rigorous and constructive, with reviewers providing valuable insights that helped enhance the quality of our work. The editorial team was highly supportive and responsive, making the submission process smooth and efficient. The journal's commitment to high standards and academic rigor makes it a respected platform for quality research. I am grateful for the opportunity to publish in such a reputable journal.
My experience publishing in International Journal of Clinical Case Reports and Reviews was exceptional. I Come forth to Provide a Testimonial Covering the Peer Review Process and the editorial office for the Professional and Impartial Evaluation of the Manuscript.
